미해결 질문Consider a DNA template strand of the following sequence:5'-A C T G C C A G G A A T-3'.A) What is the sequence of the corresponding DNA coding strand? Include directionality. DNA Template Strand: 5'-A C T G C C A G G A A T-3'. DNA Coding Strand:B) What is the sequence of the corresponding mRNA strand? Include directionality. mRNA Strand:4630views44rank
객관식Which of the following polypeptide chains are synthesized from the RNA sequence:5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'3386views26rank