Skip to main content
Back

DNA Structure, Packaging, and Chromatin Organization

Study Guide - Smart Notes

Tailored notes based on your materials, expanded with key definitions, examples, and context.

DNA Structure and Determination

Chargaff's Rules

Chargaff's rules describe the base composition of DNA, which laid the foundation for understanding its structure.

  • Rule 1: In any DNA sample, the amount of adenine (A) equals thymine (T), and the amount of guanine (G) equals cytosine (C).

  • Significance: These rules suggested specific base pairing, which was later explained by the double-helix model.

  • Example: If a DNA molecule contains 30% A, it must also contain 30% T; the remaining 40% is split equally between G and C.

Double Helix Model

The double helix model of DNA was proposed by Watson and Crick in 1953, based on X-ray diffraction data produced by Rosalind Franklin.

  • Structure: DNA is a long, thin, helical molecule with two strands wound around each other.

  • Backbone: The sugar-phosphate backbone is on the outside, while the nitrogenous bases are on the inside, forming "steps" in a spiral staircase.

  • Dimensions: There are ten nucleotide pairs per complete turn, with 0.34 nm per nucleotide and a helix diameter of about 2 nm.

  • Base Pairing: A pairs with T via two hydrogen bonds; G pairs with C via three hydrogen bonds.

Replication of Genetic Information

The double helix model suggested a mechanism for DNA replication.

  • Template Mechanism: The two strands can separate, and each acts as a template for synthesis of a new complementary strand.

  • Semiconservative Replication: Each daughter DNA molecule contains one parental and one newly synthesized strand.

  • Equation: (semiconservative model)

DNA Supercoiling and Packaging

Supercoiling

Supercoiling refers to the twisting of the DNA double helix upon itself, which helps compact the DNA.

  • Positive Supercoil: Twisting DNA in the same direction as the helix.

  • Negative Supercoil: Twisting DNA in the opposite direction.

  • Function: Extensive supercoiling makes chromosomal DNA more compact and is essential for DNA packaging in both prokaryotes and eukaryotes.

  • Topoisomerases: Enzymes that induce or relax supercoils by introducing transient breaks in DNA.

  • Equation:

Denaturation and Renaturation

DNA strands are held together by hydrogen bonds and can be separated (denatured) by heat or pH changes. Renaturation (reannealing) is the process of reforming the double helix.

  • Melting Temperature (): The temperature at which half of the DNA is denatured.

  • GC Content: Higher GC content increases due to stronger hydrogen bonding and stacking forces.

  • Equation:

Higher Order DNA Structure and Chromatin

Nucleosomes and Chromatin Packaging

Eukaryotic DNA is packaged into chromatin, which consists of DNA and proteins (mainly histones).

  • Histones: Small, basic proteins (H1, H2A, H2B, H3, H4) that bind DNA and facilitate its compaction.

  • Nucleosome: The basic unit of chromatin, consisting of a histone octamer (2x H2A, H2B, H3, H4) wrapped by 146 bp of DNA.

  • Linker DNA: DNA between nucleosomes, associated with histone H1.

  • 30-nm Fiber: Nucleosomes are further packed into a 30-nm fiber, stabilized by histone H1.

Chromatin Remodeling and Histone Modifications

Chromatin structure can be dynamically regulated by chemical modifications of histone tails and chromatin remodeling proteins.

  • Histone Acetylation: Addition of acetyl groups (by HATs) loosens chromatin and increases gene transcription.

  • Histone Methylation: Addition of methyl groups (by methyltransferases) can either activate or repress transcription, depending on the site.

  • Histone Code: Combinations of modifications create a code that regulates chromatin activity.

  • Chromatin Remodeling: Proteins (e.g., SWI/SNF family) reposition nucleosomes to make DNA more or less accessible.

  • Domains: Chromodomains bind methylated histones (closed chromatin); bromodomains bind acetylated histones (open chromatin).

Chromatin States and Chromosome Structure

Euchromatin vs. Heterochromatin

Chromatin exists in two main states:

  • Euchromatin: Loosely packed, transcriptionally active.

  • Heterochromatin: Highly compacted, transcriptionally inactive.

  • Facultative Heterochromatin: Can switch between euchromatin and heterochromatin.

  • Constitutive Heterochromatin: Permanently compacted, found at centromeres and telomeres.

Centromeres and Telomeres

Centromeres and telomeres are specialized chromosomal regions with structural and functional roles.

  • Centromeres: Regions of highly repetitive DNA (CEN sequences) that maintain sister chromatid cohesion and serve as attachment sites for spindle microtubules during cell division.

  • Telomeres: Found at chromosome ends, contain repetitive sequences (e.g., TTAGGG in vertebrates) that protect against degradation and maintain chromosome stability.

Repeated DNA Sequences

Tandemly Repeated DNA

Tandem repeats (satellite DNA) are multiple copies of DNA sequences arranged next to each other.

  • Types: Minisatellites (102–105 bp), microsatellites/STRs (10–100 bp).

  • Function: Used in forensic analysis and chromosome stability.

  • Example: GTTACGTTACGTTACGTTACGTTAC

Interspersed Repeated DNA

Interspersed repeats are scattered throughout the genome and can be hundreds or thousands of bases long.

  • Abundance: Account for 25–50% of mammalian genomes.

  • Function: Contribute to genome organization, regulation, and structural support.

Summary Table: Types of DNA in the Human Genome

Type

Description

Example/Function

Exons

Protein-coding regions

Gene expression

Introns

Non-coding regions within genes

Regulation, alternative splicing

Tandem Repeats

Satellite DNA, minisatellites, microsatellites

Chromosome stability, forensics

Interspersed Repeats

Scattered repetitive sequences

Genome organization

Key Concepts Review

  • DNA structure: Double helix, base pairing, backbone.

  • Supercoiling: DNA compaction via twisting.

  • Denaturation/Renaturation: Strand separation and reannealing.

  • Packaging: Nucleosomes, chromatin fibers, histones.

  • Higher order structure: 30-nm fiber, chromosomal scaffold.

  • Histone modifications: Acetylation, methylation, chromatin remodeling.

  • Centromeres, telomeres, repeated DNA: Structural and regulatory roles in chromosomes.

Additional info: Academic context was added to expand on brief points and clarify relationships between chromatin structure, DNA packaging, and genetic regulation.

Pearson Logo

Study Prep