Question 1

Which of the following best describes semiconservative replication of DNA in prokaryotes?

Accepted Answer

Each daughter DNA molecule consists of one parental strand and one newly synthesized strand.

Question 2

During the initiation of DNA synthesis in bacteria, which structure forms at the origin of replication and what is its significance?

Accepted Answer

Theta structure; it allows bidirectional replication from a single origin.

Question 3

Which of the following is an example of an essential non-protein-coding DNA sequence in prokaryotes, and why is it essential?

Accepted Answer

Origin of replication; it is required to initiate DNA synthesis.

Question 4

What is the primary function of the protein DNA gyrase in prokaryotic cells?

Accepted Answer

To introduce negative supercoils into DNA, relieving torsional strain during replication.

Question 5

Which of the following best explains why GC-rich DNA requires a higher temperature to denature than AT-rich DNA?

Accepted Answer

GC pairs form three hydrogen bonds, while AT pairs form only two.

Question 6

Which of the following sequences represents the mRNA transcribed from the DNA template strand 3'–ATATTACCAGGCATGGACCCCGGG–5'?

Accepted Answer

5'–UAUAAUGGUCCGUACCUGGGGCCC–3'

Question 7

Which of the following is NOT a function of sigma factors in bacterial RNA synthesis?

Accepted Answer

They catalyze the formation of peptide bonds during translation.

Question 8

Why is the half-life of mRNA generally much shorter than that of rRNA and tRNA in bacteria?

Accepted Answer

mRNA is rapidly degraded to allow quick changes in gene expression.

Question 9

Which of the following best describes the arrangement of genes A, B, and C involved in a single pathway on a bacterial chromosome?

Accepted Answer

They are organized in an operon, transcribed as a single mRNA.

Question 10

Which of the following statements about the Central Dogma of molecular biology is correct?

Accepted Answer

Genetic information flows from DNA to RNA to protein.

Question 11

Which of the following is a reason why expressing bacterial genes in eukaryotic cells can be problematic?

Accepted Answer

Eukaryotic cells may not recognize bacterial promoters or ribosome binding sites.

Question 12

Which of the following is TRUE regarding the principle of bidirectional replication in prokaryotes?

Accepted Answer

Replication proceeds in both directions from the origin, creating two replication forks.

Question 13

Which of the following is the correct sequence of events in bacterial transcription initiation?

Accepted Answer

RNA polymerase binds to the promoter, recognizes the Pribnow box, and begins RNA synthesis.

Question 14

Which of the following is a method by which prokaryotes terminate RNA transcription?

Accepted Answer

Formation of a hairpin loop followed by a string of uracils in the RNA.

Question 15

Which of the following best explains why proteins are NOT the only biomolecules capable of catalyzing bond formation?

Accepted Answer

Ribozymes, which are RNA molecules, can also catalyze bond formation.

Question 16

A circular DNA molecule isolated from a bacterium contains genes for capsule formation, pili, antibiotic resistance, and an origin of replication. What is this genetic element?

Accepted Answer

A plasmid

Question 17

Which of the following best describes the difference between transcription and translation in bacteria?

Accepted Answer

Transcription synthesizes RNA from DNA, while translation synthesizes protein from mRNA.

Question 18

Why does transcriptional-translational coupling occur in bacteria but not in eukaryotes?

Accepted Answer

Bacteria lack a nuclear membrane, allowing ribosomes to access mRNA as it is being transcribed.

Question 19

Given the DNA sequence 3’–CCT GCG TAG TGA TAC GTT AAT GCT GCC TTG TC–5’, which strand is the template for transcription and what is the direction of transcription?

Accepted Answer

The bottom (3’ to 5’) strand is the template; transcription proceeds 5’ to 3’.

Question 20

Using the codon table, what is the polypeptide sequence encoded by the mRNA 5’–GGA CGC AUC ACU AUG CAA UUA CGA CGG AAC AG–3’?

Accepted Answer

Glycine–Arginine–Isoleucine–Threonine–Methionine–Glutamine–Leucine–Arginine–Arginine–Asparagine–Serine

Microbiology Midterm Study Guide: DNA Replication, Transcription, Translation, and Genetic Elements

Guida di studio - Domande di pratica

Study guide - Flashcard