Scelta multipla
What is their proper sequence for these steps?
1. translation
2. RNA processing
3. transcription
4. modification of protein
1. translation
2. RNA processing
3. transcription
4. modification of protein
2406
views
15. Gene Expression
Review of Transcription vs. Translation
Indietro15. Gene Expression
Review of Transcription vs. Translation
- Scelta multiplaWhich of the following does not occur during translation?818views
- Scelta multiplaWhat is a significant difference between translation in bacterial cells and eukaryotic cells?839views
- Scelta multiplaWhich of the following is NOT a difference between DNA and RNA synthesis?545views
- Scelta multiplaWhy is RNA synthesis called transcription and protein synthesis called translation?789views
- Scelta multiplaWhich of the following is true of transcription but not translation?806views
- Scelta multiplaWhich of the following is a similarity between transcription and translation?851views
- Scelta multiplaWhich statement best describes the relationship between transcription and translation?787views
- Scelta multiplaWhich process is depicted in the image below, where RNA is synthesized from a DNA template?105views
- Scelta multiplaAt one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred __________.1997views
- Scelta multiplaWhich summary of protein synthesis is correct?2656views
- Scelta multiplaWhat is the relationship between transcription and translation in the process of gene expression?857views
- Scelta multiplaWhich of the following correctly distinguishes transcription from translation in eukaryotic cells?165views
- Scelta multipla
Which of the following polypeptide chains are synthesized from the RNA sequence:
5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'
3492views26rank - Scelta multiplaWhich of the following is true of both transcription and translation?768views