IndietroStructure and Function of Nucleic Acids, Proteins, and Carbohydrates
Guida di studio - Note intelligenti
Appunti personalizzati basati sui tuoi materiali, ampliati con definizioni chiave, esempi e contesto.
Key Concepts in Cell Biology
Nucleic Acids
Nucleic acids are essential macromolecules that store and transmit genetic information in cells. Their structure and function are determined by the arrangement of nucleotide bases and the types of bonding between them.
Bases: The nitrogenous bases in nucleic acids are adenine (A), thymine (T), guanine (G), cytosine (C) (in DNA), and uracil (U) (in RNA).
Numbering: The carbons in the sugar component of nucleotides are numbered 1' to 5', which is important for describing the directionality of nucleic acid strands.
Bonding: Nucleotides are joined by phosphodiester bonds between the 3' hydroxyl and 5' phosphate groups.
Protein Structure
Proteins are polymers of amino acids that fold into specific structures, which determine their function. Protein structure is described at four hierarchical levels:
Primary structure: The linear sequence of amino acids in a polypeptide chain.
Secondary structure: Local folding patterns such as α-helices and β-sheets, stabilized by hydrogen bonds.
Tertiary structure: The overall three-dimensional shape of a single polypeptide, formed by interactions among side chains.
Quaternary structure: The arrangement of multiple polypeptide subunits in a protein complex.
Carbohydrates
Carbohydrates are organic molecules composed of sugars and their derivatives. They serve as energy sources and structural components in cells.
Monosaccharides: Simple sugars such as glucose and fructose.
Polysaccharides: Long chains of monosaccharide units, such as starch, glycogen, and cellulose.
Energy storage: Polysaccharides like starch and glycogen store energy in plant and animal cells, respectively.
Anatomy of Base Pairing in Nucleic Acids
Complementary Base Pairing
Complementary base pairing is a fundamental property of nucleic acids, enabling the accurate transmission of genetic information.
Adenine (A) pairs with Thymine (T) in DNA via two hydrogen bonds.
Guanine (G) pairs with Cytosine (C) via three hydrogen bonds.
This specificity ensures the fidelity of DNA replication and transcription.
Example: In a DNA strand with the sequence 5'-ATGC-3', the complementary strand is 3'-TACG-5'.
The DNA Molecule: Double-Stranded Helix
Structure of DNA
DNA consists of two antiparallel and complementary strands that twist around a common axis to form a right-handed double helix.
The backbone is composed of alternating sugar and phosphate groups.
The bases project inward and form specific pairs (A-T, G-C).
The double helix is the secondary structure of DNA, analogous to secondary structures in proteins.
Additional info: The antiparallel orientation means one strand runs 5' to 3', while the other runs 3' to 5'.
Base Pairing and RNA
RNA Structure and Folding
RNA can exist as single-stranded or double-stranded molecules. Double-stranded regions form secondary structures such as helices and stem-loops.
RNA can fold back on itself to form base pairs, creating structures like stem-loops.
Example: A stem-loop structure in RNA is formed when complementary sequences within the same strand pair together.
Example: For the sequence 5'-GACACGGUGCAACUUAGCACCGUGCA-3', a stem-loop forms where complementary regions pair.
Higher-Order RNA Structure
RNA (and DNA) can fold into complex three-dimensional (3°) structures, which depend on base pairing and other interactions.
Pairing in RNA is often between bases in different areas of the same molecule and is less extensive than in DNA.
Examples of 3° structure include tRNA and ribosomal RNA, which have intricate folding patterns essential for their function.
Additional info: The tertiary structure of RNA is stabilized by hydrogen bonds, base stacking, and interactions with metal ions.
Activity: Practice Problems
DNA and RNA Sequence Analysis
Practice activities help reinforce understanding of nucleic acid structure and base pairing.
Given DNA sequence: TGTCCAGA
Task: Write the complementary sequence and indicate the 3' and 5' ends.
Answer: The complementary sequence is ACAGGTCT (5'-ACAGGTCT-3').
Given RNA sequence: UAUUGCCAAGGACGGCAAUG
Task: Find the self-complementary sequence and draw the secondary structure (stem-loop).
Additional info: In RNA, A pairs with U, and G pairs with C. Secondary structures are important for RNA function, such as in tRNA and ribozymes.