Consider a DNA coding strand with the following sequence: 3'-C T T C A T A G C T C G-5'.
Use the genetic code to determine the corresponding amino acid sequence of the translated protein.

DNA Coding Strand: 3'- C T T C A T A G C T C G -5'

mRNA Strand:

Protein Sequence:

What is the central dogma of molecular biology directly referring to?

Consider a DNA template strand of the following sequence: 5'-A C T G C C A G G A A T-3'.

A) What is the sequence of the corresponding DNA coding strand?  Include directionality.

   DNA Template Strand:  5'-A C T G C C A G G A A T-3'.

   DNA Coding Strand:

B) What is the sequence of the corresponding mRNA strand?  Include directionality.

   mRNA Strand:

Which of the following polypeptide chains are synthesized from the RNA sequence:

5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'