객관식Which process is depicted in the image below, where RNA is synthesized from a DNA template?105views
객관식Which of the following correctly distinguishes transcription from translation in eukaryotic cells?156views
미해결 질문Consider a DNA template strand of the following sequence: 5'-A C T G C C A G G A A T-3'.A) What is the sequence of the corresponding DNA coding strand? Include directionality. DNA Template Strand: 5'-A C T G C C A G G A A T-3'. DNA Coding Strand:B) What is the sequence of the corresponding mRNA strand? Include directionality. mRNA Strand:4733views44rank2comments
객관식Which of the following polypeptide chains are synthesized from the RNA sequence:5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'3466views26rank
객관식At one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred __________. 1991views
객관식What is their proper sequence for these steps? 1. translation 2. RNA processing 3. transcription 4. modification of protein2353views