객관식
What is their proper sequence for these steps?
1. translation
2. RNA processing
3. transcription
4. modification of protein
1. translation
2. RNA processing
3. transcription
4. modification of protein
2166
views
15. Gene Expression
Review of Transcription vs. Translation
뒤로15. Gene Expression
Review of Transcription vs. Translation
- 객관식Which of the following does not occur during translation?774views
- 객관식What is a significant difference between translation in bacterial cells and eukaryotic cells?810views
- 객관식Which of the following is NOT a difference between DNA and RNA synthesis?509views
- 객관식Why is RNA synthesis called transcription and protein synthesis called translation?745views
- 객관식Which of the following is true of transcription but not translation?771views
- 객관식Which of the following is a similarity between transcription and translation?813views
- 객관식Which statement best describes the relationship between transcription and translation?741views
- 객관식Which process is depicted in the image below, where RNA is synthesized from a DNA template?90views
- 객관식At one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred __________.1943views
- 객관식Which summary of protein synthesis is correct?2519views
- 객관식What is the relationship between transcription and translation in the process of gene expression?805views
- 객관식Which of the following correctly distinguishes transcription from translation in eukaryotic cells?128views
- 객관식
Which of the following polypeptide chains are synthesized from the RNA sequence:
5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'
3346views26rank - 객관식Which of the following is true of both transcription and translation?746views