Question 1

Which of the following best describes the concept of emergent properties in biological systems?

Accepted Answer

Properties that arise from the arrangement and interaction of parts as complexity increases.

Question 2

A scientist is studying the effect of a single gene mutation on the function of a protein in a cell. Which approach is the scientist using?

Accepted Answer

Reductionism

Question 3

Which of the following is NOT one of the five unifying themes of biology?

Accepted Answer

Homeostasis

Question 4

Which statement about the flow of energy and cycling of matter in ecosystems is correct?

Accepted Answer

Energy flows through an ecosystem, entering as light and exiting as heat, while matter cycles within the ecosystem.

Question 5

Which of the following best explains why DNA is considered the universal genetic material?

Accepted Answer

DNA stores genetic information in a sequence of nucleotides that is used by all living organisms.

Question 6

A mutation changes the DNA sequence from $$\mathrm{CACGTGGAGTGAGGTCTCCT} to$$ $$\mathrm{CACGTGGAGTGAGSTCAKC}. $$What is the most likely consequence of this mutation?

Accepted Answer

It may change the amino acid sequence of the protein, potentially altering its function.

Question 7

Which of the following is an example of negative feedback regulation in biological systems?

Accepted Answer

An increase in blood glucose stimulates insulin release, which lowers blood glucose levels.

Question 8

Which of the following best describes the process of gene expression?

Accepted Answer

The use of information encoded in a gene to synthesize a functional protein.

Question 9

Which of the following is a correct statement about natural selection?

Accepted Answer

Natural selection acts on heritable variation within a population, favoring individuals with advantageous traits.

Question 10

Which of the following is an example of a homologous structure?

Accepted Answer

The forelimbs of a cat, bat, and whale, which share a similar bone structure.

Question 11

A population of bacteria is exposed to an antibiotic. Over time, most of the population becomes resistant. Which type of natural selection is most likely occurring?

Accepted Answer

Directional selection

Question 12

Which of the following best illustrates the concept of adaptation in evolution?

Accepted Answer

A population of moths becomes darker in color after industrial pollution darkens tree bark.

Question 13

Which of the following statements about the fossil record is correct?

Accepted Answer

The fossil record provides evidence of the extinction of species, the origin of new groups, and changes within groups over time.

Question 14

Which of the following is an example of an analogous structure?

Accepted Answer

The wings of a bat and the wings of an insect, which evolved independently for flight.

Question 15

Which of the following best describes stabilizing selection?

Accepted Answer

It favors intermediate variants and acts against extreme phenotypes.

Question 16

Which of the following is a direct consequence of the structure of DNA as a double helix composed of nucleotide pairs?

Accepted Answer

It allows for the accurate replication and transmission of genetic information.

Question 17

Which of the following best explains why carbon dating is useful for studying the fossil record?

Accepted Answer

It allows scientists to determine the age of fossils by measuring the decay of carbon isotopes.

Question 18

Which of the following is an example of a vestigial structure?

Accepted Answer

The human appendix, which is a remnant of a structure that had a function in ancestors.

Question 19

Which of the following best describes the relationship between structure and function in biology?

Accepted Answer

The structure of a biological component determines its function.

Question 20

Which of the following is a real-world example of how human activity has impacted the biosphere?

Accepted Answer

The increase in atmospheric $$\mathrm{CO_2$}$$ due to burning fossil fuels, leading to global warming.

Chapter 1: Evolution, Themes of Biology, and Scientific Inquiry – Study Notes

스터디 가이드 - 연습 문제

학습 가이드 - 플래시카드