Gene Expression: The Genetic Code, Translation, and Regulation

Gene Expression: Overview

Introduction to Gene Expression

Gene expression is the process by which genetic information encoded in DNA is used to produce functional products, primarily proteins. This process involves several key steps: transcription, RNA processing, translation, and regulation at multiple levels.

• Transcription: DNA is transcribed into messenger RNA (mRNA).

• RNA Processing: Pre-mRNA is modified to mature mRNA in eukaryotes.

• Translation: mRNA is decoded to synthesize proteins.

• Regulation: Gene expression is controlled at transcriptional, post-transcriptional, translational, and post-translational levels.

The Genetic Code and Translation

Translation: Protein Synthesis

Translation is the process by which the nucleotide sequence of mRNA is converted into an amino acid sequence, forming a polypeptide (protein).

• mRNA Structure: Contains a 5' cap, 5' untranslated region (UTR), coding region, 3' UTR, and poly(A) tail.

• Coding Region: Carries codons that specify amino acids.

The Genetic Code

The genetic code consists of codons, which are sequences of three consecutive mRNA nucleotides that correspond to specific amino acids or stop signals.

• Codon: Three-nucleotide sequence on mRNA.

• Start Codon: AUG (codes for methionine, initiates translation).

• Stop Codons: UAA, UAG, UGA (signal termination of translation).

• Direction: mRNA is read from 5' to 3'.

Genetic Code Table

Codon	Amino Acid
AUG	Methionine (Start)
UUU, UUC	Phenylalanine
UAA, UAG, UGA	Stop
GCU, GCC, GCA, GCG	Alanine
... (see full code for all 64 codons)	...

Redundancy and Mutation Protection

The genetic code is redundant, meaning multiple codons can code for the same amino acid. This redundancy helps protect against single base substitutions (point mutations).

• Advantage: A single nucleotide change may not alter the polypeptide sequence.

Major Players in Translation

Components of Translation

• mRNA: Contains codons specifying amino acid sequence.

• tRNA: Carries the anticodon and corresponding amino acid.

• Ribosome: Composed of rRNA and protein; site of protein synthesis.

tRNA Structure and Function

• Anticodon: Sequence complementary and antiparallel to mRNA codon.

• Amino Acid Attachment: tRNA binds amino acid at its 3' end.

Aminoacyl-tRNA Synthetase

This enzyme attaches the correct amino acid to its corresponding tRNA, a process requiring ATP.

• Specificity: Each of the 20 amino acids has a specific synthetase and tRNA(s).

• Charged tRNA: tRNA with attached amino acid is considered "charged".

Ribosome Structure and Function

• Active Site: Ribosomal RNA (rRNA) forms the catalytic site (ribozyme) for peptide bond formation.

• Sites: E (exit), P (peptidyl), A (aminoacyl).

Mechanics of Translation

N-terminus and C-terminus

Proteins are synthesized from the N-terminus (amino end) to the C-terminus (carboxyl end).

• Peptide Bond Formation: Amino acids are joined by peptide bonds, forming a polypeptide chain.

Translation Initiation

• Small Ribosomal Subunit: Binds initiator tRNA and initiation factors.

• Scanning: Small subunit + tRNA binds at 5' cap, scans mRNA for AUG start codon in the P site.

• Large Subunit Attachment: Large ribosomal subunit joins, initiation factors are released, and elongation begins.

Elongation

• Amino Acid Addition: Ribosome moves along mRNA, adding amino acids to the growing polypeptide.

• Energy Requirement: GTP hydrolysis and elongation factors are required for movement.

• Polypeptide Exit: The growing polypeptide exits through the ribosome's exit tunnel.

Termination

• Stop Codon: When a stop codon is reached, release factors bind, causing the release of the polypeptide and dissociation of ribosomal subunits.

Polyribosomes

Multiple ribosomes can translate a single mRNA simultaneously, forming a polyribosome (polysome), increasing efficiency of protein synthesis.

Regulation of Gene Expression

Levels of Regulation in Eukaryotes

• Transcriptional Regulation: Controls which genes are transcribed.

• Post-Transcriptional Regulation: Modifies mRNA after transcription.

• Translational Regulation: Controls mRNA stability, ribosome access, and translation rate.

• Post-Translational Regulation: Modifies proteins after translation to achieve functional form.

Translational Regulation

• Poly(A) Tail: Longer poly(A) tail increases mRNA stability and lifespan.

• Protein Binding: Some proteins bind mRNA, making it inaccessible to ribosomes.

• RNA Interference (RNAi): Small RNAs (e.g., miRNA) bind complementary mRNA sequences, preventing translation or leading to degradation.

Translational Regulation Table

Mechanism	Effect
Poly(A) Tail Length	Stability and lifespan of mRNA
Protein Binding	Blocks ribosome access
miRNA	Degrades or represses mRNA

Post-Translational Regulation

• Folding: Chaperone proteins assist in proper folding of polypeptides.

• Removing Amino Acids: Specific amino acids may be removed from the protein chain (e.g., insulin maturation).

• Amino Acid Modification: Addition of organic groups (acetylation, methylation, phosphorylation, ubiquitination) alters protein activity, stability, and interactions.

Post-Translational Regulation Table

Modification	Effect
Folding	Achieves functional structure
Removing Amino Acids	Activates or matures protein
Amino Acid Modification	Regulates activity, stability, and interactions

Example: Translating mRNA Sequence

Translation Practice

Given mRNA: 5' GUUAUGUUUAGGUCUCCUGUUUGAUGU 3'

• Identify start codon (AUG) and translate each codon into its corresponding amino acid using the genetic code table.

• Translation proceeds from the first AUG until a stop codon is encountered.

Example: AUG = Methionine (Met), UUU = Phenylalanine (Phe), AGG = Arginine (Arg), etc.

Additional info: For full translation, refer to the genetic code table and match each codon to its amino acid.