Genetic Code, Mutations, and DNA Repair: Study Notes for General Biology

Study Guide - Smart Notes

Tailored notes based on your materials, expanded with key definitions, examples, and context.

Genetic Code and Protein Synthesis

Start Codon and Translation Initiation

The process of translation begins when the ribosome recognizes a specific codon on the mRNA called the start codon. This codon signals the ribosome to start synthesizing a protein.

Start Codon: The most common start codon is AUG, which codes for the amino acid Methionine (Met).
Function: The start codon sets the reading frame for translation, ensuring that the mRNA is read correctly.
Example: In the sequence 5'AUGGUGAUGGCGUAGAGCCUUUGAGGAUGAG3', translation would begin at the first AUG.

Codons and Amino Acid Coding

Codons are sequences of three nucleotides on mRNA that correspond to specific amino acids or stop signals during protein synthesis.

Codon: A triplet of nucleotides (e.g., AUG, GCU, UAG).
Genetic Code: The set of rules by which information encoded in genetic material is translated into proteins.
Example: The codon wheel is used to determine which amino acid is coded by each codon.

Mutations in DNA and mRNA

Types of Mutations

Mutations are changes in the nucleotide sequence of DNA or RNA. They can affect the resulting protein and its function.

Silent Mutation: A change in the nucleotide sequence that does not alter the amino acid sequence of the protein.
Substitution Mutation: One nucleotide is replaced by another, which may change the amino acid coded.
Deletion Mutation: One or more nucleotides are removed from the sequence, potentially causing a frameshift.
Insertion Mutation: One or more nucleotides are added to the sequence, also potentially causing a frameshift.

Example: If adenine (A) is substituted for guanine (G) in a codon, the resulting amino acid may change, leading to a missense mutation.

Additional info: Frameshift mutations (caused by insertions or deletions not in multiples of three) can drastically alter the protein sequence.

DNA Repair Mechanisms

Base Excision Repair vs. Nucleotide Excision Repair

Cells have mechanisms to repair damaged DNA and maintain genetic integrity.

Base Excision Repair (BER): Removes and replaces individual damaged bases.
Nucleotide Excision Repair (NER): Removes a segment of DNA containing the damage, such as thymine dimers, and replaces it.
Example: The diagram shows a DNA segment with a damaged base being excised and replaced, typical of NER.

Thymine Dimers and DNA Damage

Thymine Dimers

Thymine dimers are a type of DNA damage caused by ultraviolet (UV) light, where two adjacent thymine bases bond together.

Cause: UV radiation induces covalent bonding between adjacent thymine bases.
Effect: Distorts the DNA structure and can block replication and transcription.
Repair: Nucleotide excision repair is the primary mechanism for removing thymine dimers.

Example: A mutation that causes two thymine bases to bind together is a thymine dimer.

mRNA Processing

Post-Transcriptional Modifications

Before mRNA leaves the nucleus, it undergoes several modifications to become mature and functional.

5' Cap Addition: A modified guanine nucleotide is added to the 5' end for stability and ribosome recognition.
Poly-A Tail Addition: A string of adenine nucleotides is added to the 3' end to protect mRNA from degradation.
Splicing: Removal of non-coding regions (introns) and joining of coding regions (exons).

Additional info: These modifications are essential for mRNA export from the nucleus and efficient translation.

Chromosome Structure and Gene Organization

Coding and Non-Coding DNA Regions

Not all DNA on a chromosome codes for proteins. Some regions are transcribed but do not contribute to the final protein product.

Coding Strand: The DNA strand whose sequence matches the mRNA (except T/U).
Template Strand: The DNA strand used as a template for mRNA synthesis.
Exons: Coding regions that are expressed in the final protein.
Introns: Non-coding regions that are removed during mRNA splicing.

Additional info: The replisome is a complex of proteins involved in DNA replication, not directly related to coding/non-coding regions.

Mutation Identification and Effects

Locating and Classifying Mutations

Mutations can be identified by comparing normal and mutated DNA or mRNA sequences. The type of mutation is classified based on the change observed.

Substitution: One base is replaced by another.
Insertion: Extra base(s) are added.
Deletion: Base(s) are removed.
Silent Mutation: No change in amino acid sequence.

Example: In the provided codon diagrams, a mutation in codon 3 may be a substitution if one base is changed.

Alternative Protein Products from mRNA

Splicing and Protein Diversity

Different proteins can be produced from the same mRNA sequence through a process called splicing.

Splicing: Removal of introns and joining of exons in various combinations.
Result: Multiple protein isoforms from a single gene.

Additional info: Alternative splicing increases protein diversity in eukaryotic cells.

Amino Acid Codon Wheel

Using the Codon Wheel

The codon wheel is a tool for translating mRNA codons into their corresponding amino acids.

How to Use: Start from the center with the first base, move outward for the second and third bases.
Start and Stop Codons: Indicated on the wheel; AUG is start, UAA/UAG/UGA are stop codons.

Example: The codon AUG codes for Methionine (Met), and UGA is a stop codon.

Summary Table: Types of Mutations

Mutation Type	Description	Effect on Protein	Example
Substitution	One base is replaced by another	May change one amino acid (missense), or have no effect (silent)	GAA → GAG (Glu → Glu, silent)
Insertion	Extra base(s) added	Frameshift, alters downstream amino acids	GAA → GAAC (frameshift)
Deletion	Base(s) removed	Frameshift, alters downstream amino acids	GAA → GA (frameshift)
Silent	Change does not alter amino acid	No effect on protein sequence	GAA → GAG (both code for Glu)

Key Equations and Concepts

Central Dogma of Molecular Biology:

Transcription: Synthesis of mRNA from DNA template.
Translation: Synthesis of protein from mRNA template.