Q: Suppose a DNA sequence is read as $$ 5'\text{-}TGACCTGAATGGCTGGGCTG\text{-}3' . $$What would be the complementary RNA sequence transcribed from this DNA template?

$$ 5'\text{-}ACUGGACUUACCGA CCCGAC\text{-}3' $$

Question 1

Which of the following best describes the primary structure shown in the sequence $$ 5'	ext{-}TGACCTGAATGGCTGGGCTG	ext{-}3' $$?

Accepted Answer

A sequence of nucleotides forming a segment of DNA.

Question 2

In the context of DNA sequencing, what is the main advantage of using ionic current basecalling?

Accepted Answer

It allows for direct detection of nucleotide sequences without the need for fluorescent labeling.

Question 3

A researcher is analyzing a DNA sequence using ionic current basecalling. Which of the following is a potential disadvantage of this technique?

Accepted Answer

It may have a higher error rate in distinguishing between similar nucleotides.

Question 4

Which of the following best explains how ionic current basecalling identifies DNA bases?

Accepted Answer

By measuring changes in ionic current as DNA passes through a nanopore.

Question 5

Suppose a DNA sequence is read as $$ 5'	ext{-}TGACCTGAATGGCTGGGCTG	ext{-}3' . $$What would be the complementary RNA sequence transcribed from this DNA template?

Accepted Answer

$$ 5'	ext{-}ACUGGACUUACCGA CCCGAC	ext{-}3' $$

Question 6

A student claims that ionic current basecalling can be used to sequence both DNA and RNA. Is this statement accurate, and why?

Accepted Answer

Yes, because both DNA and RNA can be passed through a nanopore to generate ionic current changes.

Question 7

Which of the following is a likely reason why ionic current basecalling might produce errors when sequencing homopolymer regions (e.g., a stretch of several Gs in a row)?

Accepted Answer

The ionic current changes may be too similar for consecutive identical bases, making it difficult to distinguish the exact number.

Question 8

If a DNA sequence is given as $$ 5'	ext{-}TGACCTGAATGGCTGGGCTG	ext{-}3' $$, what is the total number of nucleotides in this sequence?

Accepted Answer

20

Question 9

A scientist wants to sequence a viral genome rapidly in the field. Which feature of ionic current basecalling makes it particularly suitable for this application?

Accepted Answer

It allows for portable, real-time sequencing without the need for large laboratory equipment.

Question 10

Which of the following best describes a key difference between DNA and RNA as implied by the study materials?

Accepted Answer

DNA contains thymine, while RNA contains uracil.

Question 11

During ionic current basecalling, which physical property of the DNA or RNA molecule is directly measured?

Accepted Answer

The change in ionic current as nucleotides pass through a nanopore.

Question 12

A DNA sequence is analyzed using ionic current basecalling, and the resulting data shows ambiguous base calls at several positions. Which of the following is the most likely explanation?

Accepted Answer

The ionic current signals for certain nucleotides are too similar, leading to uncertainty in base identification.

Question 13

Which of the following is NOT a plausible advantage of ionic current basecalling compared to traditional Sanger sequencing?

Accepted Answer

It requires fluorescently labeled nucleotides for detection.

Question 14

If a mutation occurs in the DNA sequence $$ 5'	ext{-}TGACCTGAATGGCTGGGCTG	ext{-}3' $$ changing the 5th base from C to A, what will be the new sequence?

Accepted Answer

$$ 5'	ext{-}TGAAC TGAATGGCTGGGCTG	ext{-}3' $$

Question 15

Which of the following scenarios would most likely lead to a false positive result in ionic current basecalling?

Accepted Answer

Contaminating ions in the solution alter the measured current.

Guided Study: DNA Analysis Techniques and Basecalling

Study Guide - Practice Questions

Study Guide - Flashcards