Phylogeny and the Tree of Life: Study Notes

Phylogeny and the Tree of Life

Introduction

Phylogeny is the study of the evolutionary history and relationships among species or groups of related species. Understanding phylogeny helps biologists classify organisms, interpret evolutionary patterns, and predict features of ancestral species. This chapter covers key concepts in phylogenetic analysis, including taxonomy, systematics, tree construction, homology vs. analogy, and cladistics.

Objectives

• Understand what a phylogeny shows and does not show.

• Distinguish between homology (homologous traits) and homoplasy (analogous traits).

• Learn terminology used to describe phylogenetic trees.

Looks Can Be Deceiving

Superficial Similarities vs. Evolutionary Relationships

• Organisms may appear similar due to convergent evolution, not shared ancestry.

• Example: Legless lizards and snakes both lack limbs, but legless lizards possess movable eyelids, while snakes do not.

• Physical resemblance does not always indicate close evolutionary relationship.

Phylogeny, Taxonomy, and Systematics

Definitions

• Phylogeny: The evolutionary history of a species or group of related species.

• Taxonomy: The science of naming and classifying organisms.

• Systematics: The study of biological diversity in an evolutionary context, combining taxonomy and phylogeny.

• Systematics uses fossil, morphological, behavioral, and molecular data to classify organisms and determine relationships.

Taxonomic Hierarchy

• Species are grouped into increasingly broad categories:

Taxonomic Rank	Example
Domain	Eukarya
Kingdom	Animalia
Phylum	Chordata
Class	Mammalia
Order	Carnivora
Family	Felidae
Genus	Panthera
Species	Panthera pardus

• Binomial nomenclature: Genus species (e.g., Varanus komodoensis).

• Broader taxa (e.g., Class Mammalia) may have greater genetic/morphological diversity than other classes.

Systematics and Phylogenetic Trees

• Systematics depicts evolutionary relationships in branching phylogenetic trees.

• Taxonomic classification and phylogeny may differ; species may be reclassified to reflect evolutionary relationships.

• Example: American badger and European otter may be renamed/reclassified based on phylogenetic data.

Phylogenetic Trees

Purpose and Interpretation

• Phylogenetic trees depict evolutionary relationships among organisms.

• Trees are estimated from morphological, molecular, and other data.

• Can be used to predict occurrence of:

  • Adaptive radiations: Rapid speciation due to new ecological niches.

  • Mass extinctions: Catastrophic events that eliminate many species.

Terminology

• Branch point: Where lineages diverge.

• Ancestral lineage: The common ancestor of taxa.

• Taxon: A named group of organisms.

• Sister taxa: Groups that share an immediate common ancestor.

• Basal taxon: A lineage that diverged early in the history of the group.

• Polytomy: A branch point with more than two descendant lineages (unresolved pattern).

Tree Features

• Show patterns of descent, not phenotypic similarity.

• Terminal taxa ("tips" or terminal nodes) did NOT evolve from each other.

• Provide information about shared characteristics among closely related species.

Constructing Phylogenies

Data Sources

• Morphological, biochemical, and genetic characteristics are used.

• Homologies: Phenotypic/genetic similarities due to shared ancestry.

• Organisms sharing homologous traits are predicted to be more closely related.

Analogous Characters and Homoplasy

Definition and Examples

• Homoplasy: Analogous characters; similarities not resulting from common ancestry.

• Result from convergent evolution (independent evolution of similar traits).

• Example: Ichthyosaurs (extinct reptiles) and dolphins (mammals) have similar body shapes, but do not share a recent common ancestor.

Convergent Evolution

Homology vs. Analogy

• Wings in pterosaurs, bats, and birds are homologous as forelimbs (same bones as other tetrapods).

• Wings are analogous as wings (evolved independently from forelimbs of flightless ancestors).

• Homology is generally more complex than analogy.

Molecular Homologies

DNA and Molecular Data

• Molecular systematics: Uses DNA and other molecular data to determine evolutionary relationships.

• DNA sequences may be similar by coincidence alone (molecular homoplasy).

• Computer programs and mathematical algorithms are used to identify molecular homologies.

Sequence 1	Sequence 2
ACGGATAGTCCACTAGGCACTA	TCACCGACAGGTCTTTGACTAG

Additional info: More than 20% of base pairs may be shared between non-closely related organisms due to molecular homoplasy.

Tree Groupings

Types of Groups

Group Type	Definition
Monophyletic	Single common ancestor and all its descendants
Paraphyletic	Single common ancestor but not all descendants
Polyphyletic	Species with different common ancestors

• Para- and polyphyletic groups are artifacts of incorrect classifications and are not valid groupings.

Cladistics

Grouping by Common Descent

• Clade: Group of species that includes a common ancestor and all its descendants (monophyletic group).

• Synapomorphies: Shared derived characters; traits shared because the common ancestor had them. Define monophyletic groupings.

• Shared ancestral characters: Traits that originated in the ancestor of the taxon; found further back than the common ancestor of the group.

Taxa	Vertebral Column	Hinged Jaws	Four Walking Legs	Amnion	Hair
Lamprey	1	0	0	0	0
Bass	1	1	0	0	0
Frog	1	1	1	0	0
Turtle	1	1	1	1	0
Leopard	1	1	1	1	1

Outgroup and Ingroup

• Outgroup: Species or group that diverged before the group of interest.

• Ingroup: Species being studied.

• Compare ingroup species with outgroup(s) to determine derived vs. ancestral characteristics.

• If outgroup and ingroup share a character, it is considered ancestral.

Branch Lengths in Phylogenetic Trees

Interpretation

• Branch lengths can reflect the number of genetic changes that occurred in a lineage.

• Branch lengths can also represent chronological time, with branch points determined from the fossil record.

Trees as Hypotheses

Predicting Ancestral Features

• Phylogenetic trees can be used to predict features of common ancestors using features of descendants (phylogenetic bracketing).

• Example: Dinosaurs probably had four-chambered hearts, sang courtship songs, built nests, and brooded their eggs.

• Fossil record supports nest building and brooding in many species of dinosaurs.

Phylogeny Can Reveal Unexpected Patterns

Case Study: Astragalus Bone in Artiodactyls

• The astragalus (ankle bone) is a synapomorphy that identifies artiodactyls as a monophyletic group.

• If whales are related to hippos, then two changes occurred in the astragalus.

Review/Important Concepts

• Constructing phylogenetic trees reveals evolutionary history and relationships of species/groups.

• Homology: Similarity due to shared ancestry; defines evolutionary relationships.

• Analogy: Similarity due to convergent evolution; can be problematic in constructing phylogenies.

• Monophyletic group: Valid phylogenetic term; includes ancestor and all descendants.

• Paraphyletic and polyphyletic groups: Not valid phylogenetic terms; do not include all descendants or have multiple ancestors.