Protein Structure, Genetic Mutations, and Hair Texture: General Biology Study Notes

Protein Structure and Hair Texture

Chemical Basis of Hair Strength and Texture

Hair strength and texture are determined by the protein structure of keratin and the chemical bonds within and between keratin molecules. Disulfide bonds play a crucial role in providing mechanical strength and stability to hair fibers.

• Keratin: A fibrous protein that forms the main structural component of hair, nails, and skin.

• Disulfide Bonds: Covalent bonds formed between sulfur atoms of cysteine residues in keratin, contributing to hair's strength and shape.

• Hydrogen Bonds: Weaker bonds that help maintain hair's structure but are easily disrupted by water and heat.

• Cosmetic Treatments: Chemical treatments (e.g., perming, relaxing) alter disulfide bonds to change hair texture.

Example: Perming solutions break and reform disulfide bonds, allowing hair to take on a new shape.

Human Hair Diversity

Human hair exhibits significant variation across populations, including differences in shape, curl, and color. These differences are influenced by genetic and environmental factors.

• Strongest Hair: Associated with round follicles and more evenly distributed disulfide bonds.

• Curly and Coily Hair: More common among individuals of African descent, linked to oval or asymmetrical follicles and higher density of uneven distribution of disulfide bonds.

• Asian and South Asian Hair: Intermediate follicle shapes and bond associations, resulting in straight, thick, and more resistant hair.

• Porosity: High-porosity hair (often from heat or chemical damage) absorbs water quickly but loses it rapidly, while low-porosity hair resists water penetration but retains moisture longer.

Additional info: Hair porosity affects how hair responds to products and environmental conditions.

Protein Chemistry and Structure

Disulfide Bonds and Protein Folding

Disulfide bonds are crucial for stabilizing protein structure. They form between cysteine residues and contribute to the tertiary and quaternary structure of proteins.

• Disulfide Bond Formation: $\ce{R-SH + HS-R' \rightarrow R-S-S-R' + 2H^+}$

• Protein Folding: The arrangement of amino acids into secondary, tertiary, and quaternary structures, stabilized by various bonds.

• Hydrogen Bonds: Important for secondary structure (e.g., alpha helices, beta sheets).

Example: The difference in hair texture is partly due to the number and arrangement of disulfide bonds in keratin.

Protein Mutations and Their Effects

Mutations in the DNA sequence can lead to changes in the amino acid sequence of proteins, potentially altering their structure and function.

• Types of Mutations: Silent, missense, nonsense, and frameshift mutations.

• Missense Mutation: A single nucleotide change results in a different amino acid.

• Nonsense Mutation: A change that introduces a premature stop codon.

• Frameshift Mutation: Insertions or deletions that shift the reading frame, altering downstream amino acids.

Example: Sickle cell anemia is caused by a missense mutation in the beta-globin gene, changing glutamic acid to valine.

Genetic Code and Protein Synthesis

DNA, RNA, and Codons

The genetic code is composed of codons, sequences of three nucleotides that correspond to specific amino acids. DNA is transcribed into mRNA, which is then translated into protein.

• Transcription: The process of copying DNA into mRNA.

• Translation: The process of converting mRNA into a sequence of amino acids (protein).

• Codon Table: Used to determine which amino acid corresponds to each mRNA codon.

Equation: $\text{DNA} \xrightarrow{\text{transcription}} \text{mRNA} \xrightarrow{\text{translation}} \text{Protein}$

Case Study: Sickle Cell Anemia

Sickle cell anemia is a genetic disorder caused by a mutation in the hemoglobin gene. This mutation leads to abnormal hemoglobin structure and sickle-shaped red blood cells.

• Normal Sequence: $3'\text{TATATATACCTGAGGCTGGAAGGAGTCTACTTCTT}5'$

• Mutant Sequence: $3'\text{TATATATACCTGAGGCTGGAAGGAGTCTACTTCTT}5'$ (with a single nucleotide change)

• Effect: The mutation changes the amino acid sequence, affecting the protein's tertiary structure and the shape of red blood cells.

Additional info: Sickle cell anemia is an example of how a single nucleotide change can have significant physiological effects.

Environmental and Physical Factors Affecting Hair

Impact of Heat and Chemicals

Environmental factors such as heat and chemical exposure can alter hair structure by breaking or reforming chemical bonds.

• Heat Styling: Temporarily breaks hydrogen bonds, allowing hair to be reshaped.

• Chemical Treatments: Permanently alter disulfide bonds, changing hair texture.

• Return to Natural Pattern: Hair may revert to its natural curl pattern after heat styling as hydrogen bonds reform.

Variation Across Populations

Genetic and Environmental Contributions

Differences in hair texture and shape among populations are influenced by both genetic factors (e.g., follicle shape, bond distribution) and environmental factors (e.g., climate, hair care practices).

• Genetic Variation: Determines follicle shape and bond arrangement.

• Environmental Factors: Influence hair health and appearance.

Integrative and Ethical Questions

Perceptions of Hair Texture

Social and cultural perceptions of hair texture influence scientific research and personal identity. Understanding these perceptions is important for ethical considerations in biology and medicine.

• Example: Cultural attitudes toward curly versus straight hair can affect research priorities and healthcare practices.

Tables

Comparison of Mutation Types

The following table summarizes the main types of genetic mutations and their effects:

Mutation Type	Description	Effect on Protein
Silent	Change in DNA sequence does not alter amino acid	No effect
Missense	Change in DNA sequence alters one amino acid	May affect protein function
Nonsense	Change introduces a stop codon	Truncated protein
Frameshift	Insertion or deletion shifts reading frame	Major changes to protein sequence

Codon Table (Excerpt)

The codon table is used to translate mRNA codons into amino acids:

Codon	Amino Acid
UUU	Phe
AUG	Met (Start)
GAA	Glu
GUA	Val
UAA	Stop

Summary

Understanding the chemical and genetic basis of protein structure, mutations, and hair texture is essential in general biology. These concepts illustrate how molecular changes can have significant effects on phenotype and health.