Question 1

Which of the following best describes a ribozyme?

Accepted Answer

Enzyme-like RNA

Question 2

During DNA replication, which enzyme is responsible for relieving the tension ahead of the replication fork?

Accepted Answer

Topoisomerase

Question 3

How does the synthesis of the leading strand differ from the lagging strand during DNA replication?

Accepted Answer

The leading strand is synthesized continuously, while the lagging strand is synthesized in short fragments called Okazaki fragments.

Question 4

What does it mean that DNA replication is 'semi-conservative'?

Accepted Answer

Each new DNA molecule contains one parental strand and one newly synthesized strand.

Question 5

Shortened telomeres are associated with which of the following outcomes?

Accepted Answer

Increased risk of cancer

Question 6

Which strand of DNA is the mRNA sequence identical to (except for the presence of uracil)?

Accepted Answer

Coding strand

Question 7

True or False: Transcription requires a primer to occur.

Accepted Answer

False

Question 8

Given the DNA template strand 3'-CGATGCTAG-5', what is the corresponding mRNA sequence?

Accepted Answer

$$5'GCUACGAUC3'$$

Question 9

Which two modifications are added to eukaryotic mRNA to make it mature?

Accepted Answer

Poly-A tail and 5' cap

Question 10

What part of the tRNA binds to the codon on mRNA?

Accepted Answer

Anticodon loop

Question 11

How many nucleotides code for a single amino acid?

Accepted Answer

3

Question 12

Which of the following is a molecular chaperone?

Accepted Answer

Molecules that fold the finished protein

Question 13

Translate the mRNA sequence $$5'ACGAUGCCGAAUUAAGCCCG3'$$ using the codon wheel. What is the resulting amino acid sequence?

Accepted Answer

Thr-Met-Pro-Asn-Lys-Pro

Question 14

What is the difference between genotype and phenotype?

Accepted Answer

Genotype is the genetic makeup; phenotype is the observable trait.

Question 15

Which of the following mutations can cause a frameshift?

Accepted Answer

Deletion and insertion

Question 16

Order the following molecules from most to least soluble across a cell membrane: H$$_2O$$, Sucrose, N$$_2$$, K$$^+.$$

Accepted Answer

N$$_2$$ \u003e H$$_2O$$ \u003e Sucrose \u003e K$$^+$$

Question 17

What is the main function of cholesterol in animal cell membranes?

Accepted Answer

It stabilizes membrane fluidity across temperature changes.

Question 18

Which site in the ribosome is responsible for holding the tRNA carrying the growing polypeptide chain?

Accepted Answer

P site

Question 19

A patient is exposed to UV radiation, which causes thymine dimers in DNA. What type of mutation is most likely to result?

Accepted Answer

Deletion mutation

Question 20

True or False: Every time there is a change in the genotype, there is a change in the phenotype.

Accepted Answer

False

Study Guide: Molecular Biology and Genetics Essentials

Study Guide - Practice Questions