Question 1

Which of the following is the most accurate and inclusive definition of a gene?

Accepted Answer

A segment of DNA, including the promoter and regulatory regions, that gets transcribed, gets translated, and has a function.

Question 2

Assume a gene for feather coloration has four alleles: A1=Green, A2=Red, A3=Blue, A4=White. Complete dominance is as follows: $$A1 \u003e A2 \u003e A3 \u003e A4. If $$you get a bird with red feathers, which of the following options is NOT its genotype at the feather gene?

Accepted Answer

A1A2

Question 3

Orange color is completely dominant in hamsters. What is the probability that the two hamsters (diagonal arrows in the pedigree) will have another orange pup?

Accepted Answer

$$0.5$$

Question 4

Orange color is recessive in ferrets. What is the probability that the two ferrets (diagonal arrows in the pedigree) will have another orange pup?

Accepted Answer

$$0.25$$

Question 5

You cross a BROWN rough tomato (rrss) with a dihybrid (RrSs). You get 160 offspring. How many do you expect to be Red and Smooth?

Accepted Answer

$$40$$

Question 6

Two autosomal genes control wing color and number in fruit flies. Gene 1: Two wings or four wings. Gene 2: Yellow wings or translucent wings. You cross a male with Four translucent wings with a female with Two yellow wings. All 100 offspring are dihybrid and have Two translucent wings. What is the genotype of the male fly?

Accepted Answer

Homozygous recessive for gene 1; Homozygous dominant for gene 2

Question 7

Remy is planning to have a child with Anne-Marie, who has JeanGrey (a rare autosomal recessive disorder). Remy does not show telekinesis and does not know his genotype, but his sister does have JeanGrey. A genetic counselor tells them the probability their child will develop JeanGrey is $$50\%. $$Can Remy eventually develop the disease? Why?

Accepted Answer

No, Remy is Heterozygote

Question 8

Assume broccoli has three genes: A=Delicious, a=awful; B=Green, b=brown; C=big size, c=small size. The highlighted alleles are completely dominant. You cross AaBbCc x aabbcc and obtain 160 plants. How many will be Delicious, Green, and Big?

Accepted Answer

$$20$$

Question 9

Assume this is the coding (non-template) strand from a prokaryotic gene: $$5'	ext{GCGTAAATGAAAGCAGGTATTAACCC}-3'. $$What is the corresponding translated polypeptide?

Accepted Answer

Met-Lys-Ala-Gly-Ile-Asn

Question 10

Put the following events in the order that they occur in a eukaryotic gene: A. The RNA gets a 5' cap; B. Translation begins; C. The RNA receives a Poly-A tail; D. Transcription begins; E. Transcript exits the nucleus; F. Introns are spliced.

Accepted Answer

D, A, F, C, E, B

Question 11

Given the mRNA sequence $$5'	ext{AUG AGU UUG AAA UCG UGG UUU GUA}\ldots 3'$$, which of the following options shows the polypeptide that will result from translation?

Accepted Answer

Met-Ser-Leu-Lys-Ser-Trp-Phe-Val

Question 12

In the ribosome diagram, what amino acid is Letter B (assuming the mRNA codon at that position is UUU)?

Accepted Answer

Phenylalanine

Question 13

Which tRNA will enter the A site if the next mRNA codon is UGG?

Accepted Answer

tRNA with anticodon ACC carrying Tryptophan

Question 14

Which of the following represents a missense mutation?

Accepted Answer

A codon change that results in a different amino acid, such as GAA to GAC

Question 15

You have two black long-haired male hamsters of unknown genotype. Each is crossed with a double recessive white short-haired hamster. Cross 1 results: 5 white short hair, 5 white long hair, 5 black short hair, 5 black long hair. Cross 2 results: 20 black long hair. What are the genotypes of the two black long-haired male hamsters? Assume complete dominance.

Accepted Answer

Male Hamster 1: CcSs; Male Hamster 2: CCSS

Question 16

A mutation changes the DNA sequence from $$5'	ext{GAA}\ldots 3' to$$ $$5'	ext{GAC}\ldots 3'. $$What type of mutation is this?

Accepted Answer

Missense mutation

Question 17

A tomato plant with genotype RrSs is crossed with a plant with genotype rrss. What proportion of the offspring will be brown and rough?

Accepted Answer

$$1/4$$

Question 18

In a dihybrid cross AaBb x aabb, what fraction of the offspring will be homozygous recessive for both genes?

Accepted Answer

$$1/4$$

Question 19

A mutation in the promoter region of a gene most likely affects which process?

Accepted Answer

Transcription initiation

Unit 4 Review: Mendelian Genetics, Gene Expression, and Mutations

Study Guide - Practice Questions

Study Guide - Flashcards