A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What is the height potential of the F₁ progeny of the homozygous plants identified in (a) and (b) of this problem?

Sanders 3rd Edition
Ch. 15 - Recombinant DNA Technology and Its Applications
Problema 27bYou have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.
How would you show that the expression pattern of the enhancer trap line reflects the endogenous gene expression pattern of the adjacent gene?
Guida verificata passo dopo passo
Risposta video verificata per un problema simile:
Concetti chiave
Enhancer Traps
Gene Expression Patterns
In Situ Hybridization
Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?
You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.
How can you identify the gene adjacent to the insertion site of the enhancer trap?
In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.
How will you create loss-of-function alleles of the mouse genes?
In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.
How will you determine whether the mouse genes have redundant functions?
The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.
ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA
GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC