Question 1

Which property of carbon makes it the backbone of all biological molecules?

Accepted Answer

Carbon can form up to four covalent bonds, allowing for a diversity of stable structures.

Question 2

The Stanley Miller experiment demonstrated that:

Accepted Answer

Organic molecules may have been synthesized abiotically on early Earth.

Question 3

Which of the following molecules is considered organic?

Accepted Answer

Glucose ($$C_6H_{12}O_6$)

Question 4

How many covalent bonds can a carbon atom form, and why is this significant for biological molecules?

Accepted Answer

Four; it allows for complex and diverse molecular structures.

Question 5

Which of the following best describes an isomer?

Accepted Answer

Molecules with the same molecular formula but different structures.

Question 6

A molecule with the formula $$C_6H_{12}O_6$ can be glucose or fructose. What type of isomers are these?

Accepted Answer

Structural isomers

Question 7

Which chemical group acts as an acid by donating $$H^+$$ ions?

Accepted Answer

Carboxyl group ($$-COOH)$$

Question 8

What is the main function of triacylglycerol in animals?

Accepted Answer

Energy storage

Question 9

Which of the following statements about phospholipids is correct?

Accepted Answer

They have two fatty acids and a phosphate group, forming bilayers in membranes.

Question 10

Which type of bond connects fatty acids to glycerol in fats?

Accepted Answer

Ester linkage

Question 11

Why do plants store energy as starch while animals store energy as fat?

Accepted Answer

Fat is more efficient for long-term energy storage due to its higher energy density.

Question 12

Which of the following is a function of proteins in cells?

Accepted Answer

Catalyzing biochemical reactions

Question 13

What determines the primary structure of a protein?

Accepted Answer

The sequence of amino acids

Question 14

What happens to a protein when it is denatured?

Accepted Answer

Its three-dimensional structure is lost, often resulting in loss of function.

Question 15

Which of the following best describes the difference between DNA and RNA?

Accepted Answer

DNA is usually double-stranded, while RNA is usually single-stranded.

Question 16

A sample contains the sequence $$5'\ CGGCACCGCCCTAAGTCTCT\ 3'. If $$this matches the standard sequence for Atlantic salmon, what does this indicate?

Accepted Answer

The sample is mislabeled if it was sold as Coho salmon.

Question 17

Which of the following is a function of nucleic acids?

Accepted Answer

Storing and transmitting genetic information

Question 18

Which chemical group is found in all amino acids?

Accepted Answer

Carboxyl group ($$-COOH)$$

Question 19

Which of the following best explains why enzymes are specific to their substrates?

Accepted Answer

The three-dimensional shape of the enzyme matches only specific substrates.

Question 20

Which of the following statements about ATP is correct?

Accepted Answer

ATP stores energy in the bonds between its phosphate groups.

elthing L1

Study Guide - Practice Questions