From Gene to Protein: The Flow of Genetic Information

Study Guide - Smart Notes

Tailored notes based on your materials, expanded with key definitions, examples, and context.

Chapter 15: From Gene to Protein

Introduction

This chapter explores how genetic information encoded in DNA is used to produce proteins, the functional molecules of the cell. The process involves two main steps: transcription (DNA to RNA) and translation (RNA to protein).

Metabolism and Genes

Metabolic Defects Reveal Gene Function

Metabolic diseases such as alkaptonuria (black urine from alkapton) and phenylketonuria (PKU) provided early evidence that genes specify proteins.
Each disease is caused by a non-functional enzyme, demonstrating that genes create phenotype by encoding enzymes.

Example: In PKU, a mutation in the gene for phenylalanine hydroxylase leads to the accumulation of phenylalanine and its toxic byproducts.

Metabolic Pathways and Genetic Blocks

Enzymes catalyze each step in a metabolic pathway. A mutation in a gene encoding an enzyme can block the pathway, leading to disease.

Enzyme	Protein	Block Leads To
Phenylalanine hydroxylase	Phenylalanine → Tyrosine	Phenylketonuria (PKU)
Homogentisic acid oxidase	Homogentisic acid → Maleylacetoacetic acid	Alkaptonuria
Other enzymes	Various steps	Albinism, Cretinism, Tyrosinosis

One Gene–One Enzyme Hypothesis

Beadle & Tatum's Experiments

Used Neurospora (bread mold) to show that genes control the production of specific enzymes.
Created mutants using X-rays, which inactivated genes.
Wild type grew on minimal media; mutants required added amino acids, indicating a block in a specific metabolic step.
Conclusion: Non-functional enzyme = broken gene.

Beadle & Tatum's Neurospora Experiment

Strain	Gene Mutated	Growth Requirement
Wild type	None	Minimal media
Class I	Gene A	Ornithine, Citrulline, or Arginine
Class II	Gene B	Citrulline or Arginine
Class III	Gene C	Arginine only

Interpretation: Each gene encodes a specific enzyme in the arginine biosynthesis pathway.

What is a Gene?

Definitions and Complications

One gene–one enzyme: Not all proteins are enzymes, but all proteins are coded by genes.
One gene–one protein: Many proteins are made of multiple polypeptides, each encoded by a separate gene.
One gene–one polypeptide: Some genes only code for RNA, not proteins.
One gene–one product: Some genes produce multiple products due to alternative splicing and other mechanisms.

Additional info: The modern definition of a gene is a DNA sequence that can be transcribed and processed into a functional product (protein or RNA).

The Central Dogma of Molecular Biology

Flow of Genetic Information

DNA → RNA → Protein
Transcription: DNA is used as a template to make RNA.
Translation: RNA is used as a template to make protein.
Replication: DNA is copied to make more DNA.

From Nucleus to Cytoplasm

Location of Genes and Protein Synthesis

Genes are located on chromosomes in the nucleus.
Proteins are synthesized in the cytoplasm by ribosomes.
Messenger RNA (mRNA) carries genetic information from the nucleus to the cytoplasm.

RNA Structure and Types

Key Features of RNA

Ribose sugar (instead of deoxyribose in DNA)
Nitrogenous bases: Uracil (U) replaces thymine (T); U pairs with A, C pairs with G.
Single-stranded molecule
Types: mRNA, rRNA, tRNA, siRNA

Transcription

Overview

The template strand of DNA is used to synthesize a complementary RNA strand.
The coding strand is not transcribed but has the same sequence as the RNA (except T is replaced by U).
RNA polymerase is the enzyme responsible for transcription.

Transcription in Prokaryotes

Initiation

RNA polymerase binds to the promoter sequence on DNA.
The promoter determines where transcription starts, which strand is read, and the direction (always 3' to 5' on DNA).

Promoter Sequences

Common sequences: -35 (TTGACA) and -10 (TATAAT) upstream of the start site.

Elongation

RNA polymerase unwinds DNA (~20 base pairs at a time).
Reads DNA 3' → 5', synthesizes RNA 5' → 3'.
No proofreading; error rate is about 1 per 105 bases.

Termination

RNA polymerase stops at a termination sequence.
In prokaryotes, mRNA is immediately available for translation.

Transcription in Eukaryotes

Occurs in the nucleus; mRNA must be processed before leaving for the cytoplasm.
Three types of RNA polymerase:
- RNA polymerase I: transcribes rRNA genes
- RNA polymerase II: transcribes mRNA genes
- RNA polymerase III: transcribes tRNA genes
Each recognizes specific promoter sequences.
Transcription factors bind to promoter regions (e.g., TATA box) to help RNA polymerase bind and initiate transcription.

Post-Transcriptional Processing (Eukaryotes)

Primary transcript (pre-mRNA) is modified before translation.
5' cap and poly-A tail are added to protect mRNA from degradation.
Introns (noncoding regions) are removed; exons (coding regions) are spliced together to form mature mRNA.

Prokaryote vs. Eukaryote Genes

Feature	Prokaryotes	Eukaryotes
DNA Location	Cytoplasm	Nucleus
Chromosome Structure	Circular, naked	Linear, wound on histones
Introns	Absent	Present (introns and exons)

Transcription to Translation

Key Differences

In prokaryotes, transcription and translation are simultaneous; in eukaryotes, they are separated by time and space.
Eukaryotic mRNA undergoes processing before translation.

Translation in Prokaryotes

Transcription and translation occur simultaneously in the cytoplasm.
No mRNA editing is required.

From Gene to Protein: The Genetic Code

How mRNA Codes for Proteins

mRNA is read in sets of three nucleotides called codons.
Each codon specifies one amino acid.
There are 20 amino acids and only 4 nucleotide bases (A, U, G, C), so the code is read in triplets (64 possible codons).

Example: DNA: TACGCACATTTACGTACGCGG → mRNA: AUGCGUGUAAAUGCAUGCGCC → Protein: Met Arg Val Asn Ala Cys Ala

Cracking the Code

Nirenberg & Matthaei (1960s): Determined the first codon-amino acid match (UUU codes for phenylalanine).
Used artificial mRNA and cell-free systems to decipher the genetic code.

Summary Table: Key Terms and Concepts

Term	Definition
Gene	DNA sequence that codes for a functional product (protein or RNA)
Transcription	Synthesis of RNA from a DNA template
Translation	Synthesis of protein from an mRNA template
Codon	Three-nucleotide sequence on mRNA that codes for an amino acid
Exon	Coding region of a gene
Intron	Noncoding region of a gene

Key Equations and Concepts

Central Dogma:
- DNA RNA Protein
Transcription:
- Template strand read 3' 5', RNA synthesized 5' 3'
Translation:
- mRNA codons are read by tRNA anticodons at the ribosome to assemble amino acids into a polypeptide chain.