Q: In the Central Dogma of molecular biology, what is the correct sequence of information flow?

$$\text{DNA} \rightarrow \text{RNA} \rightarrow \text{Protein}$$

Question 1

Which metabolic disease provided early evidence that genes specify proteins by causing a non-functional enzyme, resulting in black urine due to the accumulation of alkapton?

Accepted Answer

Alkaptonuria

Question 2

Beadle and Tatum’s experiments with Neurospora fungus led to which foundational hypothesis about gene function?

Accepted Answer

One gene - one enzyme

Question 3

In the Central Dogma of molecular biology, what is the correct sequence of information flow?

Accepted Answer

$$	ext{DNA} ightarrow 	ext{RNA} ightarrow 	ext{Protein}$$

Question 4

Which of the following statements best explains why defining a gene is problematic?

Accepted Answer

Some genes code for several protein products, some only for RNA, and genes can overlap.

Question 5

During transcription in prokaryotes, what is the role of the promoter sequence?

Accepted Answer

It determines where RNA polymerase should start reading, which strand to read, and the direction.

Question 6

Which enzyme is responsible for synthesizing RNA from a DNA template during transcription?

Accepted Answer

RNA polymerase

Question 7

What is the difference between the coding strand and the template strand in transcription?

Accepted Answer

The template strand is transcribed into RNA; the coding strand is not.

Question 8

Which of the following is a unique feature of eukaryotic genes compared to prokaryotic genes?

Accepted Answer

Eukaryotic genes contain introns and exons.

Question 9

What post-transcriptional modifications occur to eukaryotic mRNA before it is translated?

Accepted Answer

Addition of a 5' cap and poly-A tail, and removal of introns

Question 10

In the genetic code, how many nucleotide bases are required to code for one amino acid?

Accepted Answer

Three

Question 11

Which experiment demonstrated that UUU codes for phenylalanine, helping to crack the genetic code?

Accepted Answer

Nirenberg and Matthaei’s poly(U) mRNA experiment

Question 12

Which of the following is NOT a function of tRNA during translation?

Accepted Answer

Synthesizing mRNA from DNA

Question 13

What is the role of the ribosome during translation?

Accepted Answer

It facilitates the coupling of tRNA anticodon to mRNA codon and catalyzes peptide bond formation.

Question 14

Which site on the ribosome holds the tRNA carrying the growing polypeptide chain?

Accepted Answer

P site (peptidyl-tRNA site)

Question 15

Why is there no proofreading during transcription in prokaryotes?

Accepted Answer

mRNA has a short life and many copies are made, so errors are not worth correcting.

Question 16

Which of the following best describes the difference in transcription and translation between prokaryotes and eukaryotes?

Accepted Answer

In prokaryotes, transcription and translation are simultaneous and occur in the cytoplasm.

Question 17

Which enzyme attaches the correct amino acid to its corresponding tRNA, using ATP in an endergonic reaction?

Accepted Answer

Aminoacyl tRNA synthetase

Question 18

A mutation in the gene encoding the enzyme that converts phenylalanine to tyrosine leads to which metabolic disorder?

Accepted Answer

Phenylketonuria (PKU)

Question 19

Which of the following statements about the genetic code is TRUE?

Accepted Answer

The code is redundant; multiple codons can code for the same amino acid.

Question 20

If the DNA coding strand sequence is $$	ext{TACGCACATTTACGTACGCGG}$$, what is the corresponding mRNA sequence?

Accepted Answer

$$	ext{AUGCGUGUAAAUGCAUGCGCC}$$

From Gene to Protein: The Flow of Genetic Information

Study Guide - Practice Questions

Study Guide - Flashcards