Q: Given the DNA template strand 3'-CGTACCAAGTCGCATCGATTT-5', what is the corresponding mRNA sequence?

$$5'\text{-}GCAUGGUCAAGCGUAGCUAAA\text{-}3'$$

Q: Which of the following sequences is the correct mRNA transcript for the DNA template strand 3'-TACGGTACC-5'?

$$5'\text{-}AUGCCAUGG\text{-}3'$$

Question 1

Which of the following best describes the Central Dogma of Molecular Biology?

Accepted Answer

DNA is transcribed into mRNA, which is then translated into protein.

Question 2

A mutation changes the DNA sequence from 5'-AATGTGCCG-3' to 5'-AGTGTGCCG-3'. What type of mutation is this, and what is its likely effect on the protein product?

Accepted Answer

It is a missense mutation; one amino acid will be changed in the protein.

Question 3

Which of the following statements about the genetic code is FALSE?

Accepted Answer

It is ambiguous, meaning one codon can specify more than one amino acid.

Question 4

Given the DNA template strand 3'-CGTACCAAGTCGCATCGATTT-5', what is the corresponding mRNA sequence?

Accepted Answer

$$5'	ext{-}GCAUGGUCAAGCGUAGCUAAA	ext{-}3'$$

Question 5

Which codon serves as the start codon for translation, and what amino acid does it code for?

Accepted Answer

AUG; Methionine

Question 6

A frameshift mutation occurs due to the insertion of a single nucleotide in the coding region of a gene. What is the most likely consequence?

Accepted Answer

The reading frame will shift, altering all downstream amino acids.

Question 7

Which of the following best explains why retroviruses, such as HIV, are exceptions to the Central Dogma?

Accepted Answer

They use RNA as a template to synthesize DNA.

Question 8

If a DNA sequence is mutated from 5'-GAG-3' to 5'-GTG-3', and this results in sickle cell anemia, what type of mutation has occurred?

Accepted Answer

Missense mutation

Question 9

Which of the following is NOT a function of mRNA?

Accepted Answer

Transferring amino acids to the ribosome

Question 10

A mutation changes a codon from UAU (tyrosine) to UAA. What is the result of this mutation?

Accepted Answer

A nonsense mutation

Question 11

Which of the following best describes the role of tRNA in translation?

Accepted Answer

It brings specific amino acids to the ribosome based on the mRNA codon.

Question 12

Why is the genetic code described as 'redundant'?

Accepted Answer

Some amino acids are specified by more than one codon.

Question 13

Which of the following sequences is the correct mRNA transcript for the DNA template strand 3'-TACGGTACC-5'?

Accepted Answer

$$5'	ext{-}AUGCCAUGG	ext{-}3'$$

Question 14

Which of the following is a property of the genetic code that allows scientists to use bacteria to produce human proteins?

Accepted Answer

The code is universal.

Question 15

A mutation in the third base of a codon often does not change the amino acid specified. This is an example of which property of the genetic code?

Accepted Answer

Redundancy

Question 16

Which of the following best explains why a frameshift mutation is usually more severe than a point mutation?

Accepted Answer

It changes the reading frame, altering all downstream amino acids.

Question 17

Which of the following is the correct sequence of events in gene expression in eukaryotic cells?

Accepted Answer

Transcription in the nucleus, translation in the cytoplasm

Question 18

A scientist observes that a mutation in a gene leads to a shorter, non-functional protein. Which type of mutation most likely occurred?

Accepted Answer

Nonsense mutation

Question 19

Which of the following best describes the relationship between genotype and phenotype?

Accepted Answer

Genotype determines the sequence of DNA, which is transcribed and translated to produce phenotype.

How Genes Work: From DNA to Protein and the Genetic Code

Study Guide - Practice Questions

Study Guide - Flashcards