Question 1

Which of the following is NOT considered a property of life as discussed in Biology 107?

Accepted Answer

Ability to photosynthesize

Question 2

Why is it important for conservation biologists to classify and monitor species such as the South China Tiger?

Accepted Answer

To measure and monitor biodiversity and track which species are extant, endangered, or extinct

Question 3

Which of the following best describes homologous structures?

Accepted Answer

Structures that are inherited from a common ancestor and may have similar or different functions

Question 4

A bat’s wing and a bird’s wing are considered analogous structures because:

Accepted Answer

They have similar functions but evolved independently

Question 5

Which method provides the most accurate measure of evolutionary relatedness between two species?

Accepted Answer

Comparing DNA or protein sequences

Question 6

Given the following DNA sequences for three organisms:
A: agtcgctagctagctgactgcatgcagtcgactgactg
B: agtcactaactaggtgactgcatgcattcgactaactg
C: agtcactagctagctgacttcatgcattcgactaactg
If A and B have 3 sequence differences, B and C have 9, and A and C have 10, which pair is most closely related?

Accepted Answer

A and B

Question 7

Which of the following best describes a phylogram?

Accepted Answer

A diagram where branch lengths are proportional to the amount of genetic change

Question 8

Why might physical structures alone be unreliable for determining evolutionary relationships?

Accepted Answer

Analogous structures can appear similar due to convergent evolution, not common ancestry

Question 9

Which of the following is a real-world example of a homologous structure?

Accepted Answer

A dolphin’s flipper and a human arm

Question 10

A student is comparing the DNA sequences of three species to construct a cladogram. What is the primary information the cladogram will show?

Accepted Answer

The branching order of evolutionary relationships

Question 11

Which of the following is a key reason for requiring lab coats and safety glasses in Biology 107 labs?

Accepted Answer

To protect students from chemical and biological hazards

Question 12

Which of the following best explains why DNA evidence is often unavailable from fossils?

Accepted Answer

DNA degrades over time and is rarely preserved in fossilized remains

Question 13

Which of the following is an example of evolutionary adaptation?

Accepted Answer

A giraffe’s long neck allowing it to reach high leaves

Question 14

If a student wants to compare the evolutionary distance between three species using DNA, which formula would best represent the number of differences between two sequences?

Accepted Answer

$$D = \sum_{i=1}^{n} (A_i 
eq B_i)$$

Question 15

Which of the following is NOT a recommended strategy for success in Biology 107?

Accepted Answer

Ignoring material presented in class

Question 16

Which of the following best describes the difference between a cladogram and a phylogram?

Accepted Answer

A cladogram shows only branching order, while a phylogram shows branching order and evolutionary distance

Question 17

Which of the following is a plausible reason for requiring full-length pants and full-coverage shoes in the laboratory?

Accepted Answer

To prevent exposure to hazardous chemicals and biological materials

Question 18

Which of the following is an example of a real-world application of taxonomy?

Accepted Answer

Tracking the spread of an endangered species to inform conservation efforts

Question 19

Which of the following statements about analogous structures is correct?

Accepted Answer

They have similar functions but different evolutionary origins

Question 20

A student is constructing a phylogram using DNA sequence data. If the branch length between two species is twice as long as between another pair, what does this indicate?

Accepted Answer

There are more genetic differences between the two species

LEC 1: Introduction to Biology: Properties of Life, Classification, and Phylogeny

Study Guide - Practice Questions

Study Guide - Flashcards