Question 1

Which of the following best describes the structure of DNA?

Accepted Answer

A double helix composed of nucleotides with a deoxyribose sugar-phosphate backbone and nitrogenous bases forming the rungs.

Question 2

During DNA replication, what does 'semiconservative' mean?

Accepted Answer

Each new DNA molecule contains one old strand and one new strand.

Question 3

Which equation correctly represents the number of possible codons given four nucleotide bases and a three-letter code?

Accepted Answer

$$4^3 = 64$

Question 4

What is the primary function of DNA polymerase during DNA replication?

Accepted Answer

Binding new nucleotides to the parent strand and proofreading for errors.

Question 5

Which of the following statements about the antiparallel nature of DNA is correct?

Accepted Answer

One strand runs 5’ to 3’, while the other runs 3’ to 5’.

Question 6

Which enzyme is responsible for joining Okazaki fragments during DNA replication?

Accepted Answer

DNA ligase

Question 7

A mutation occurs when DNA polymerase fails to correct a mismatched nucleotide. What is the typical error rate after proofreading?

Accepted Answer

1 in 50 billion base pairs

Question 8

Which of the following is NOT a difference between DNA and RNA?

Accepted Answer

DNA is found in the cytoplasm, while RNA is only in the nucleus.

Question 9

What is the role of the promoter during transcription?

Accepted Answer

It is a sequence of DNA nucleotides that signals the start of a gene for RNA polymerase.

Question 10

Which of the following best describes the process of nucleotide excision repair?

Accepted Answer

Nuclease excises damaged DNA, DNA polymerase fills the gap, and DNA ligase seals the nick.

Question 11

Which of the following is a pyrimidine base found in DNA?

Accepted Answer

Thymine

Question 12

During translation, what is the function of tRNA?

Accepted Answer

It transports amino acids to the ribosome and matches its anticodon to the mRNA codon.

Question 13

If a DNA sequence is TACCAGAAGCTAGATCATAGGTTGTACATT, what would be the corresponding mRNA sequence?

Accepted Answer

AUGGUCUUCGUAGAUCAUAGGUUGUACAU

Question 14

Which of the following statements about codons is correct?

Accepted Answer

Codons are three-letter sequences on mRNA that code for amino acids or start/stop signals.

Question 15

Why must a purine always pair with a pyrimidine in DNA?

Accepted Answer

To maintain a consistent width of 2 nm for the DNA double helix.

Question 16

Which of the following is a correct description of the central dogma of molecular biology?

Accepted Answer

DNA → RNA → Polypeptide

Question 17

What is the significance of redundant codons in the genetic code?

Accepted Answer

They provide a buffer against mutations, as several codons can code for the same amino acid.

Question 18

Which of the following best describes the role of ribosomes during translation?

Accepted Answer

They serve as a workbench for protein assembly, reading mRNA and catalyzing peptide bond formation.

Question 19

Which of the following is a real-life consequence of a mutation in DNA repair mechanisms?

Accepted Answer

Accumulation of DNA errors, potentially leading to cancer.

Question 20

During transcription, which base pairs with adenine on the DNA template?

Accepted Answer

Uracil

Molecular Biology of the Gene: DNA and RNA Structure, Replication, and Protein Synthesis

Study Guide - Practice Questions