Question 1

Which statement best describes semi-conservative DNA replication?

Accepted Answer

Each new DNA molecule contains an old strand and a new strand.

Question 2

Which nucleotide is found in RNA but not in DNA?

Accepted Answer

Uracil

Question 3

During transcription, what is the role of RNA polymerase?

Accepted Answer

It unwinds and unzips the DNA molecule at the locus for the protein that is about to be manufactured.

Question 4

If cytosine (C) makes up 22% of the nucleotides in a sample of DNA, what percent of the bases would be adenine (A)?

Accepted Answer

28%

Question 5

Which of the following is a correct sequence of nucleotides on a strand of RNA?

Accepted Answer

UAUCUGACUA

Question 6

A nucleotide contains which of the following components?

Accepted Answer

All of these are components of a nucleotide.

Question 7

Which type of RNA shuttles amino acids to the ribosome during protein synthesis?

Accepted Answer

Transfer RNA (tRNA)

Question 8

What is the end product of translation?

Accepted Answer

Protein

Question 9

Which component is NOT directly involved in translation?

Accepted Answer

DNA

Question 10

The Central Dogma of molecular biology states that one gene on DNA codes for one _________.

Accepted Answer

Protein

Question 11

How many codons are present in the genetic code?

Accepted Answer

64

Question 12

A sequence of three nucleotides on mRNA is known as:

Accepted Answer

Codons

Question 13

Which of the following is NOT a correct example of base-pairing in DNA?

Accepted Answer

Guanine with adenine

Question 14

In eukaryotic cells, DNA is stored in the:

Accepted Answer

Nucleus

Question 15

During protein synthesis, tRNA shuttles ______ to the mRNA/ribosome complex.

Accepted Answer

Amino acids

Question 16

Which of the following best describes the sequence of events from DNA to protein?

Accepted Answer

Transcription \rightarrow RNA editing \rightarrow translation

Question 17

What is the significance of the redundancy in the genetic code?

Accepted Answer

It allows multiple codons to code for the same amino acid, reducing the impact of mutations.

Question 18

If a DNA sequence is TACCATGATCCGTAGAGCTTTGGCTACATT, what would be the corresponding mRNA sequence?

Accepted Answer

AUGGUACUAGGCAUCUCGAAACCGAUGUAA

Question 19

Using the genetic code chart, what amino acid does the codon UGU code for?

Accepted Answer

Cys

Question 20

A biochemist found that a bacterium produced an mRNA molecule of 852 nucleotides and translated this mRNA into a polypeptide containing 233 amino acids. How many nucleotides in the mRNA message would actually be needed to carry the message for the polypeptide?

Accepted Answer

$$233 	imes 3 = 699$$

Study Guide: DNA, RNA, and Protein Synthesis Concepts for BIOL 110

Study Guide - Practice Questions

Study Guide - Flashcards