Question 1

Which experiment provided definitive evidence that DNA, and not protein, is the genetic material in phages infecting E. coli?

Accepted Answer

Hershey and Chase's blender experiment

Question 2

According to Chargaff’s rules, which equation correctly represents the relationship between the bases in double-stranded DNA?

Accepted Answer

$$A = T$$ and $$G = C$$

Question 3

What is the primary function of DNA ligase during DNA replication?

Accepted Answer

Joins Okazaki fragments on the lagging strand

Question 4

Which nitrogenous base is complementary to guanine in DNA?

Accepted Answer

Cytosine

Question 5

The antiparallel structure of DNA means:

Accepted Answer

One strand runs 5' to 3', the other runs 3' to 5'

Question 6

During DNA replication, why can new DNA only be synthesized in the 5' to 3' direction?

Accepted Answer

DNA polymerase can only add nucleotides to the 3' end

Question 7

What is the semiconservative model of DNA replication?

Accepted Answer

Each new DNA molecule contains one old strand and one new strand

Question 8

Which enzyme is responsible for unwinding the DNA double helix at the replication fork?

Accepted Answer

Helicase

Question 9

What is the role of telomeres in eukaryotic chromosomes?

Accepted Answer

They protect chromosome ends from degradation and prevent fusion with other chromosomes

Question 10

Which cells produce telomerase, and why is this important?

Accepted Answer

Stem cells and germ cells; to maintain chromosome length and allow continued division

Question 11

In the polymerase chain reaction (PCR), what is the purpose of the denaturation step?

Accepted Answer

To separate double-stranded DNA into single strands

Question 12

Which of the following is NOT a function of DNA polymerase during replication?

Accepted Answer

Joining Okazaki fragments

Question 13

What is the function of single-strand binding proteins (SSBP) during DNA replication?

Accepted Answer

They stabilize unwound DNA strands and prevent them from reannealing

Question 14

Which of the following best describes Okazaki fragments?

Accepted Answer

Short DNA fragments synthesized on the lagging strand

Question 15

Which equation represents the number of hydrogen bonds between adenine and thymine in DNA?

Accepted Answer

$$A-T$$ pairs have 2 hydrogen bonds

Question 16

What is the main reason cancer cells can continue dividing indefinitely?

Accepted Answer

They express telomerase, maintaining telomere length

Question 17

Which protein relieves strain caused by unwinding of the DNA double helix?

Accepted Answer

Topoisomerase

Question 18

Which of the following is a promising application of CRISPR-Cas9 technology?

Accepted Answer

Editing genes to treat genetic diseases

Question 19

If a DNA sequence is $$5'	ext{–}TCAGCGTAAGGTGATGTATA	ext{–}3'$$, what is the complementary strand?

Accepted Answer

$$3'	ext{–}AGTCGCATTCCACTACATAT	ext{–}5'$$

Question 20

Which of the following is NOT an application of PCR?

Accepted Answer

Synthesizing proteins in cells

Study Guide: The Molecular Basis of Inheritance – DNA Structure and Replication

Study Guide - Practice Questions