Question 1

Which of the following best describes an auxotroph in the context of bacterial genetics?

Accepted Answer

A microorganism that is unable to synthesize a specific essential compound due to a gene mutation.

Question 2

A bacterial strain has a mutation that changes a codon from $	ext{UAC}$ (tyrosine) to $	ext{UAA}$ (stop codon). What type of mutation is this?

Accepted Answer

Nonsense mutation

Question 3

Which of the following best explains the difference between selection and screening in microbial genetics?

Accepted Answer

Selection allows only mutants to grow, while screening allows both mutants and wild type to grow for phenotypic identification.

Question 4

A frameshift mutation is most likely to result from which of the following genetic changes?

Accepted Answer

Insertion or deletion of one or two nucleotides in the coding region

Question 5

Which of the following is a function of restriction endonucleases in bacteria?

Accepted Answer

Protecting the cell from viral DNA by cleaving foreign DNA sequences

Question 6

A bacterium is exposed to a mutagen that causes the following DNA sequence to change: $	ext{GTGCATTGCATTGGTCCATGCTACCGATGGATCGA}$ to $	ext{GTGCATTGCATTGGTCGATGCTACCGATGGATCGA}$. What is the most likely effect of this mutation?

Accepted Answer

A frameshift mutation that alters the reading frame

Question 7

Which of the following statements about transposable elements is correct?

Accepted Answer

Transposable elements can move within and between DNA molecules, sometimes carrying antibiotic resistance genes.

Question 8

In the context of CRISPR-Cas systems, what is the primary function of the 'spacer' sequences?

Accepted Answer

They serve as memory of previously encountered foreign DNA for targeted defense.

Question 9

A bacterium with a defective DNA repair system is exposed to UV light. Which of the following outcomes is most likely?

Accepted Answer

The bacterium will accumulate more mutations due to inability to repair DNA damage.

Question 10

Which of the following best describes the mechanism of conservative transposition?

Accepted Answer

A transposable element is excised from one location and inserted into another without replication.

Question 11

A researcher uses transposon mutagenesis to study gene function in Pseudomonas aeruginosa. What is the most likely outcome if a transposon inserts into a gene required for flagella synthesis?

Accepted Answer

The bacterium will lose motility due to loss of flagella function.

Question 12

Which of the following is a real-world example of a virus evading the CRISPR-Cas defense system in bacteria?

Accepted Answer

A virus mutates its protospacer adjacent motif (PAM) region to avoid recognition.

Question 13

Which of the following best explains why methylation of DNA is important in bacterial restriction-modification systems?

Accepted Answer

Methylation allows the cell to distinguish its own DNA from foreign DNA, protecting it from cleavage by its own restriction enzymes.

Question 14

A bacterial cell undergoes abortive infection in response to phage attack. What is the most likely benefit of this response for the bacterial population?

Accepted Answer

The infected cell dies, preventing the spread of new virions to neighboring cells.

Question 15

Which of the following is a key feature that makes CRISPR-Cas systems analogous to adaptive immunity?

Accepted Answer

They incorporate sequences from previously encountered invaders as spacers, providing sequence-specific defense.

Question 16

A missense mutation is best defined as:

Accepted Answer

A mutation that changes a codon to one that encodes a different amino acid.

Question 17

Which of the following is most likely to result from a silent mutation in a gene?

Accepted Answer

No change in the amino acid sequence of the protein.

Question 18

Which of the following best describes the role of Cas proteins in the CRISPR-Cas system?

Accepted Answer

They function as endonucleases that recognize and cleave foreign DNA sequences matching the spacers.

Question 19

A bacterium is found to have a high frequency of spontaneous mutations, with a mutation rate of $10^{-5}$ per gene per generation. Which of the following is the most likely explanation?

Accepted Answer

The bacterium has a defective DNA polymerase proofreading function.

Genetics of Bacteria and Archaea: Mutation, Selection, and Genomic Integrity

Study Guide - Practice Questions

Study Guide - Flashcards