Q: Which of the following statements about the Central Dogma of molecular biology is correct?

$$\text{DNA} \rightarrow \text{RNA} \rightarrow \text{Protein}$$

Q: Given the DNA sense strand 3ʹ–A T A T T A C C A G G C A T G G A C C C C C G G G–5ʹ, what is the corresponding mRNA sequence?

$$5'\text{GCCCGGGGUCCAUGCCUGGUAAUAU}3'$$

Question 1

Which of the following best describes semiconservative replication of DNA in prokaryotes?

Accepted Answer

Each daughter DNA molecule consists of one parental and one newly synthesized strand.

Question 2

During bacterial DNA replication, what is the function of DNA gyrase?

Accepted Answer

It relieves supercoiling ahead of the replication fork by introducing negative supercoils.

Question 3

Which of the following is NOT a protein-coding gene but is essential for cellular growth or replication?

Accepted Answer

Origin of replication (oriC)

Question 4

What is the role of sigma factors in bacterial RNA synthesis?

Accepted Answer

They direct RNA polymerase to specific promoter sequences to initiate transcription.

Question 5

Which sequence is recognized as the Pribnow box in bacterial promoters?

Accepted Answer

$$	ext{TATAAT}$$

Question 6

How do prokaryotes terminate RNA transcription?

Accepted Answer

By either rho-dependent or rho-independent mechanisms.

Question 7

Why does GC-rich DNA require a higher temperature to denature than AT-rich DNA?

Accepted Answer

GC pairs have three hydrogen bonds, while AT pairs have only two.

Question 8

Which of the following best describes an open reading frame (ORF)?

Accepted Answer

A sequence of DNA that begins with a start codon and ends with a stop codon, potentially encoding a protein.

Question 9

Why is the half-life of mRNA generally much shorter than that of rRNA or tRNA in bacteria?

Accepted Answer

Rapid mRNA turnover allows bacteria to quickly adapt gene expression to environmental changes.

Question 10

A circular DNA molecule isolated from a bacterium contains genes for capsule formation, pili, antibiotic resistance, and an origin of replication. What is this genetic element?

Accepted Answer

A plasmid

Question 11

Which of the following statements about the Central Dogma of molecular biology is correct?

Accepted Answer

$$	ext{DNA} ightarrow 	ext{RNA} ightarrow 	ext{Protein}$$

Question 12

Given the DNA sense strand 3ʹ–A T A T T A C C A G G C A T G G A C C C C C G G G–5ʹ, what is the corresponding mRNA sequence?

Accepted Answer

$$5'	ext{GCCCGGGGUCCAUGCCUGGUAAUAU}3'$$

Question 13

Which of the following is a reason why expressing bacterial genes in eukaryotic cells can be problematic?

Accepted Answer

Eukaryotes may not recognize bacterial promoters or ribosome binding sites.

Question 14

Which of the following is TRUE regarding the principle of bidirectional replication in prokaryotes?

Accepted Answer

Replication proceeds in both directions from the origin, creating two replication forks.

Question 15

Which statement best distinguishes transcription from translation?

Accepted Answer

Transcription synthesizes RNA from a DNA template; translation synthesizes protein from an mRNA template.

Question 16

What is the underlying reason for transcriptional-translational coupling in bacteria?

Accepted Answer

Lack of a nuclear membrane allows ribosomes to bind mRNA as it is being transcribed.

Question 17

Which of the following is NOT a component of the prokaryotic ribosome?

Accepted Answer

18S rRNA

Question 18

Which of the following statements is FALSE regarding proteins as biological catalysts?

Accepted Answer

Proteins are the only biomolecules capable of catalyzing bond formation.

Question 19

Given the DNA sequence 3’–CCT GCG TAG TGA TAC GTT AAT GCT GCC TTG TC–5’, what is the expected direction of transcription and the resulting mRNA sequence?

Accepted Answer

Transcription proceeds 5’ to 3’ using the bottom strand as template; mRNA: $$5'	ext{GGA CGC AUC ACU AUG CAA UUA CGA CGG AAC AG}3'$$

Question 20

Why does the GC content of chromosomes in microorganisms from different environments vary widely?

Accepted Answer

High GC content increases DNA stability at higher temperatures.

Microbiology Midterm Study Guidance: DNA Replication, Transcription, Translation, and Genetic Elements

Study Guide - Practice Questions

Study Guide - Flashcards