Fundamentals of Genetics Practice Problems

What type of bonds form between complementary base pairs to join two DNA strands into a double helix?

How many phosphodiester bonds will be present in a 50 base pair long double-stranded DNA molecule?

The following are the percentages of nucleotides present in the three nucleic acid samples:

Sample 1: A = 20%, G = 30%, T = 20%, U = 0%, C = 30%
Sample 2: A = 32%, G = 32%, T = 0%, U = 18%, C = 18%
Sample 3: A = 24%, G = 26%, T = 0%, U = 24%, C = 26%

Determine the correct option that accurately represents the identities of each sample.

Which of the following biomolecules is not separated by gel electrophoresis?

The HBB gene codes for a protein known as β-globin, and mutation in both alleles of the HBB gene causes sickle cell disease (SCD). The allele for wild-type β-globin protein is designated by β^A, and that for mutant β-globin protein by β^S. How many protein bands do you expect to see if you run a sample from a person with SCD through gel electrophoresis?

The HBB gene codes for a protein known as β-globin, and mutation in both alleles of the HBB gene causes sickle cell disease. The allele for wild-type β-globin protein is designated by β^A, and that for mutant β-globin protein by β^S. Determine the number of genotypes that can result from these two alleles.

Identify the sequence of the template strand of the DNA when the sequence of mRNA is as follows: 

5' AUGCUUAGUCAAAGUAAUUGA 3'

Which of the following molecules carries amino acids to ribosomes?

What is the percentage of adenine, cytosine, and thymine present in an organism if the percentage of guanine is 18%?

What type of RNA adds short peptide tags onto proteins that have been synthesized incorrectly, labeling them for immediate degradation in bacteria?

Which of the following best describes the difference between genome and proteome?

Which of the following statements regarding mutation is true?

Which of the following is the process by which organisms that are better adapted to their environment are more likely to survive and reproduce, thus passing on their advantageous traits to their offspring?

Identify the sequence of the coding strand of the DNA when the sequence of mRNA is as follows: 

5' AUGCUUAGUCAAAGUAAUUGA 3'

_____________ is the genetic makeup of an organism that is passed down from parent to offspring. 

Which of the following nucleotides is not present in RNA?

Where is the extra hydroxyl group present in the pentose sugar of RNA as compared to DNA?

What type of bonds link two consecutive nucleotides in a DNA strand?

Which of the following statements best describes the difference between the 5' and 3' ends of a nucleic acid strand?

What would be the sequence of the complementary section of DNA, if a strand of a DNA molecule has the sequence ATCGAT?

Which of the following is an example of a phenotype?

What is the significance of the antiparallel orientation of the two strands of DNA?

Which of the following is regarded as a heredity vehicle?

Which of the following is termed the basic unit of genetics?

What is the true statement regarding the process of DNA replication? 

Which of the following options correctly describes the process of translation?

All of the following structures are involved in the central dogma of molecular genetics, EXCEPT:

Which of the following is a particular form of a gene situated at a specific location on a chromosome?

During transcription, the base sequence of _____ is converted into the base sequence of _____:

Individuals that have two identical alleles for a specific gene are considered as _____ for that trait.

The physical appearance of a trait is termed _____, whereas _____ refers to the specific genetic makeup of an individual, including the combination of alleles that an individual carries for a particular gene.

_____ refers to an organism's genetic constitution. The _____, on the other hand, is the physical appearance that is both influenced by genetic makeup and environmental conditions.

Which of the following represents a DNA segment that codes for a particular protein or RNA molecule?

Recessive alleles can only produce recessive phenotype if:

What is the equivalent amino acid sequence of the following DNA template strand?

3'...CACTTTACGATACTCCCA...5'

In which of the following ways does genetics affect our lives?

One of the most significant areas of research for people is genetics because:

A gene is a sequence of _______ that determines the ________ sequence of a polypeptide.

Which of the following includes all the others?

The physical appearance of a trait is termed _____, whereas ________ refers to the precise combination of alleles resulting in a trait's phenotypic expression.

According to the chromosomal theory of inheritance, ________ are the vehicles of _________ that control all the heritable characteristics of an organism.

Which term best describes a pair of chromosomes that have the same genes in the same order, although the alleles may differ?