The Genetic Code Practice Problems

A gene with 1500 nucleotides will code for how many amino acids?

Which of the following polypeptides will not be generated from a synthetic mRNA created by a researcher using trinucleotide repeats of UGU?

Which of the following will not be the first codon in the reading frame if a researcher uses trinucleotide repeats of UGU?

Determine the number of reading frames in a synthetic mRNA constructed by a researcher using trinucleotide repeats of UUC.

Which of the following will not change the reading frame of an mRNA sequence?

A codon is a set of three-letter combinations of bases that code for a particular amino acid. Which of the following codons codes for peptide chain termination?

Which of the following features of the genetic code is incorrect?

A codon is a sequence of three nucleotides that forms a unit of genomic information encoding a particular amino acid. Which of the following lists of codons coded with amino acid is incorrect?

In a eukaryotic gene, there are three exons and two introns. The lengths of the exons and introns are as follows:

Exon 1: 150 base pairs
Exon 2: 75 base pairs
Exon 3: 100 base pairs
Intron 1: 300 base pairs
Intron 2: 200 base pairs

What is the percentage of the gene that is composed of exons?

In a study of a gene in different species, the following sequence data was obtained for a conserved region:

Species 1: AGTCCGACGT
Species 2: AGTCCGACGT
Species 3: AGTCTGACGT
Species 4: AGTCCGATGT
Species 5: AGTCCGACGT
Species 6: AGTCCGACGT

Based on the above data, determine the consensus sequence for this conserved region.

Plasmodium falciparum differs from other eukaryotic genomes because it lacks a functional _____ initiation codon for translation.

The researchers have aligned the DNA sequences of these binding sites and generated a consensus sequence for each gene. The consensus sequences are shown below:

Gene 1: 5'- GCACTGAGT -3'
Gene 2: 5'- GCTCTGAGT -3'

Based on these consensus sequences, which of the following statements is true?

In a study, a researcher has identified the binding sites of a transcription factor in several genes. They have aligned the DNA sequences of these binding sites and generated a consensus sequence. The consensus sequence for the binding site is shown below:

5'- TGTANNNNNATCACAA-3'

Using the consensus sequence, predict which of the following sequences is most likely to be a binding site for this transcription factor:

The following is the mRNA sequence for a protein translation:
AUGGCUGAUCCUGACCCU
What is the sequence for the template strand of DNA?

What is the difference between the Shine-Dalgarno (SD) sequence and the Kozak sequence?

The Shine–Dalgarno (SD) sequence is a ribosomal binding site in bacterial and archaeal messenger RNA, generally located around 8 bases upstream of the start codon AUG. The RNA sequence helps recruit the ribosome to the messenger RNA (mRNA) to initiate protein synthesis by aligning the ribosome with the start codon.  The conservation of a similar sequence between distantly related eukaryotes implied that this nucleotide tract played an important role in the cell. What is the role proposed by this sequence in eukaryotes in protein synthesis?

How many codons have no matching anticodons?

If a researcher uses dinucleotide repeats to form a synthetic mRNA and the genetic code is overlapping, how many types of amino acids will the polypeptide have?

Which of the following statements regarding posttranslational modifications is incorrect?

In humans, the disorder known as Creutzfeldt-Jakob disease (CJD) is caused by the presence in the brain of aggregates of misfolded proteins called:

How many types of polypeptides will be observed by a researcher who uses trinucleotide repeats to form a synthetic mRNA?

ATP-dependent proteases frequently digest misfolded proteins in bacteria. In eukaryotes, misfolded proteins are frequently tagged with a covalently attached small protein called:

Which of the following characteristics of the genetic code is true?

If a researcher uses dinucleotide repeats to form a synthetic mRNA, how many types of amino acids will the polypeptide have?

The sequence of a peptide is as follows: N....Met-Lys-Glu-Lys-Arg-Arg-Trp-Ser....C. Using the genetic code table, identify the correct mRNA sequence. (Pu represents a purine, and Py represents a pyrimidine).

Which of the following amino acids is (are) coded by only a single codon?

The sequence of an mRNA is 5' AUGUAUUAUUAUUAGUAUUAUUAU 3'. Identify the incorrect statement(s) related to the translation of this mRNA.

The conversion of an mRNA sequence into a polypeptide depends on interactions between mRNA and the _________.

Given the following mRNA sequence, 

5' AAGUGCGGCUUGCGCUGG 3' 

What is the amino acid sequence translated by this sequence?

Consider the following mRNA sequence.
5'- CAPGAGAUGGUAAGCAGACAGCACAUCAAGACAUUA-3'
How many start codons are present in the sequence?

Which of the following techniques was used to decipher the genetic code?

Using the coding strand of DNA for a gene with the sequence 5′-...CCAGAGTTACTTAGA...-3′, identify the amino acid sequence of the resulting polypeptide utilizing the three-letter amino acid abbreviations.

Which of the following is NOT related to the genetic code?

The genetic codes for the different amino acids are given as follows:

UAU= tyrosine

CAU= histidine 

CCC= proline

UUU= phenylalanine

What will be the possible sequence of mRNA for the following oligopeptide?

tyrosine - histidine - proline - phenylalanine

If mRNA includes five genetic codes, what is its minimum length?

The amino acid phenylalanine is specified by which of the following codons?

Which of the following is structurally similar to inosine apart from having an amino group attached to its Carbon-2?

Consider the following DNA sequences:

Wild-type DNA sequence: 5'- ATG GCT GAA TCT AGT GAC TCA GCA GTT TAT GAA AGC TCC GGA GCC -3'
Mutant DNA sequence:     5'- ATG GCT GAA TCT AGT GAG TCA GCA GTT TAT GAA AGC TCC GGA GCC -3'

In which codon does the mutant type differ from the wild type?

Which of the following will you not find in the codon table?

The sequence of an mRNA is 5' AAGGAAGGAAGGAAGGAAGG 3'. Assume that the genetic code is read as a quadruplet without overlaps and that there is no concept of start and stop codons. Identify the incorrect statement(s) based on this information regarding the translation of this mRNA.

Which of the following is the mRNA sequence encoded by the template strand 3'-TACGCTATGCTA-5'?

Identify which of the following mRNA will be translated completely.

Isoaccepting tRNAs are tRNAs that have different anticodons but can recognize the same amino acid. For leucine which is specified by six different codons, how many tRNA genes are required to recognize these codons?

In a certain organism, the amino acid alanine is coded for by the codons GCU, GCC, GCA, and GCG. The corresponding tRNA molecules in the organism recognize the codons through base pairing between the tRNA anticodon and the mRNA codon. However, some tRNA molecules can recognize multiple codons for the same amino acid due to the wobble effect.
How many different tRNA molecules are necessary to recognize all four codons for alanine in the organism described?

The wobble effect is when a single tRNA molecule can recognize and bind to multiple codons for the same amino acid during translation. This is because the ____ position of the codon (the "wobble position") can tolerate some non-standard base pairing with the corresponding position of the tRNA anticodon.

Besides the codon GGG, what is the other codon that can be recognized by anticodon CCC?

The codon GCU codes for Alanine. To recognize GCU, there must be a tRNA molecule with anticodon CGA. Based on the wobble principle, what is the other codon that can be recognized by the anticodon CGA?

What is the effect of the stop codon UAA on protein synthesis?

Given the following DNA template strand: 3'- TACGTACGTCGAGGCTATTCTAGG -5', what would be the amino acid sequence of the resulting polypeptide chain assuming that the reading frame begins with the first base of the sequence?

Given the following DNA template strand 5'- GTCAGGCTAGATCGA -3', what would be the sequence of the mRNA transcribed from this DNA template sequence?

Which of the following statements regarding overlapping genes is incorrect?

Single amino acid coded by more than one codon is called?

a. ambiguity of genetic code 

b. degeneracy of genetic code 

c. non-degeneracy 

d. unambiguous genetic code

The amino acid sequence of a peptide is as follows: Met-Cys-Cys-Tyr-Arg-Arg-Val-Thr-Tyr. Identify the number of triplets in this peptide.

The amino acid sequence of a wildtype peptide is as follows: Met-Cys-Cys-Tyr-Arg-Arg-Val-Thr-Tyr-Thr. The mutant form of the same peptide is as follows: Met-Cys-Cys-Tyr-Ser-Arg-Val-Thr-Tyr-Thr. Using the genetic code table in your genetics textbook, identify the nucleotide(s) that altered, resulting in the production of the mutant peptide.

Identify the correct sequence (from 5' to 3' end) of a typical mRNA strand's coding and noncoding parts before it undergoes translation process.

Which of the following statements about the translation process is false?

Determine which of the following mRNA sequences codes for the given amino acid sequence:

5'...Ala-Val-Thr-Asp...3'

The genetic code was said to be universal for all organisms. It was found later that the genetic code has evolved. What do these stop codons, UAA, and UAG code for in ciliated protozoans?

The codons of an mRNA are read in the 5'-3' direction. The complementary tRNA anticodon sequence for the mRNA codon 5'-AUG-3' is determined to be:

Suppose that only A and C are used for synthesizing an mRNA in a ratio of 1A : 5C. Determine the frequency of CCC appearing in the message.

Some amino acids are coded by more than one codon, making the genetic code:

Identify the most accurate role of the genetic code in the course of evolution.

Determine the number of amino acids in the peptide encoded by the following sequence: 5' AUG UUA AAA AAU UAA GCU GCC GCC 3'

Consider the following DNA sense strand:
5' ...AGCGAATTCAGCT... 3'
Which of the following gives the corresponding RNA sequence?

AUG encodes for __________ in prokaryotes.

Crick postulated the "wobble hypothesis" which is supported by the degeneracy of the genetic code. According to his postulate, what makes the third mRNA position of the codon-anticodon interaction susceptible to incorrect base pairing (Watson-Crick base pairing rule)?

Besides "wobble pairing", the degeneracy of the genetic code is also illustrated by isoacceptor tRNAs. Which of the following correctly describes isoacceptor tRNAs?

Crick proposed the "wobble hypothesis" to give an explanation for the degeneracy of the genetic code. If an anticodon GAG undergoes a "wobble pairing", to which of the following codons could it have been possibly paired besides CUC?

In silent mutation, one nitrogen base mutates into another nitrogen base but still encodes the same amino acid. This is made possible because:

Which of the following is considered the least harmful type of mutation?

In most cases, the genetic code is degenerate. That is, many of the amino acids are encoded by two, three, or four types of codons. Which of the following is made up of a single codon type?

Which of the following statements demonstrates the advantage of genetic redundancy?

When there is an accidental addition of a single nitrogen base in a DNA sequence, it can cause:

Which of the following genetic codes is not recognized by any tRNA in a human cell?

How many amino acids will be incorporated by an mRNA with the following nucleotide sequence? 

5'-AUGAGGUUUUGA-3' 

Determine the polypeptide that the following strand of mRNA specifies in humans:

5'-AUGAGGAGGAUAAUGUGGUUU-3'

The genetic code UGA in the nuclear genome is interpreted as _______, but in the mitochondrial genome, the UGA codes for __________.

Which of the following amino acids is specified by a single genetic code?

How many codons will be generated if the genetic code is thought to be a combination of two nucleotides?

The 5′→3′ direction is the only way to read genetic information. This is referred to as the ______ of the genetic code.

A genetic code is a combination of three nucleotides. What is the total number of genetic codes that will specify the twenty amino acids?

Each alpha chain of hemoglobin consists of 141 amino acids. What will be the approximate length of mRNA that will encode each alpha chain?

Determine which of the following is NOT a characteristic of the genetic code.

Which nucleotide of the codon is degenerate according to the Wobble hypothesis?