Skip to main content
Ch. 15 - Recombinant DNA Technology and Its Applications
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172당신이 사용하는 게 아니라요?교과서 변경
15장, 문제 26c

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.
How will you determine whether the mouse genes have redundant functions?

검증된 단계별 안내
1
Step 1: Begin by understanding the concept of redundant functions in genetics. Redundant functions occur when two or more genes perform overlapping roles, such that the loss of one gene does not result in a significant phenotype because the other gene compensates for its function.
Step 2: Design a genetic experiment to test redundancy. Create single knockout mice for each gene (Hoxa7 and Hoxb4) individually. This involves using techniques like CRISPR-Cas9 to specifically disrupt the function of each gene in separate mouse models.
Step 3: Observe the phenotypes of the single knockout mice. If the loss of either Hoxa7 or Hoxb4 alone does not result in a significant change in body segment identity, it suggests that the genes may have overlapping or redundant functions.
Step 4: Create a double knockout mouse model where both Hoxa7 and Hoxb4 are disrupted simultaneously. This will help determine if the combined loss of both genes results in a significant phenotype, such as altered body segment identity, which would confirm their redundant roles.
Step 5: Analyze the phenotypes of the double knockout mice and compare them to the single knockouts and wild-type mice. If the double knockout results in a distinct phenotype that is not observed in the single knockouts, it indicates that Hoxa7 and Hoxb4 have redundant functions in specifying body segment identity in mice.

비슷한 문제에 대한 검증된 영상 답변:

이 영상 해법은 위 문제에 도움이 된다고 튜터들이 추천한 것입니다.
영상 길이:
2m
도움이 되었나요?

주요 개념

질문에 올바르게 답하기 위해 반드시 이해해야 하는 핵심 개념들은 다음과 같습니다.

Hox Genes

Hox genes are a group of related genes that determine the body plan and segment identity during embryonic development in animals. They encode transcription factors that regulate the expression of other genes, influencing the formation of structures in specific body segments. The conservation of Hox genes across species, such as Drosophila and mice, highlights their fundamental role in developmental biology.
추천 영상:
가이드 코스
02:34
Plant HOX genes

Gene Redundancy

Gene redundancy occurs when two or more genes perform similar functions, allowing for compensation if one gene is mutated or lost. This phenomenon is common in developmental processes, where multiple genes can influence the same pathway or structure. Understanding redundancy is crucial for determining the functional roles of genes, especially in cases where mutations lead to observable phenotypic changes.
추천 영상:

Orthologs

Orthologs are genes in different species that evolved from a common ancestral gene and typically retain the same function. Studying orthologs, such as Hoxa7 and Hoxb4 in mice and Ultrabithorax in Drosophila, helps researchers understand evolutionary relationships and functional conservation across species. Identifying orthologs is essential for predicting gene function based on known roles in other organisms.
추천 영상:
관련 실천
교과서 질문

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.

How will you determine where and when the mouse genes are expressed?

421
views
교과서 질문

Two complaints about some transgenic plants presently in commercial use are that (1) the Bt toxin gene is constitutively expressed in them, leading to fears that selection pressures will cause insects to evolve resistance to the toxin, and (2) a selectable marker gene—for example, conferring kanamycin resistance—remains in the plant, leading to concerns about increased antibiotic resistance in organisms in the wild. How would you generate transgenic plants that produce Bt only in response to being fed upon by insects and without the selectable marker?

428
views
교과서 질문

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How can you identify the gene adjacent to the insertion site of the enhancer trap?

573
views
교과서 질문

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How would you show that the expression pattern of the enhancer trap line reflects the endogenous gene expression pattern of the adjacent gene?

572
views
교과서 질문

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.

How will you create loss-of-function alleles of the mouse genes?

402
views
교과서 질문

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC

650
views