Skip to main content
Ch. 15 - Recombinant DNA Technology and Its Applications
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172당신이 사용하는 게 아니라요?교과서 변경
15장, 문제 27a

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.
How can you identify the gene adjacent to the insertion site of the enhancer trap?

검증된 단계별 안내
1
Step 1: Extract genomic DNA from the Drosophila line containing the enhancer trap. This will provide the DNA surrounding the P element insertion site.
Step 2: Perform inverse PCR (Polymerase Chain Reaction) to amplify the DNA flanking the P element insertion. Inverse PCR involves digesting the genomic DNA with a restriction enzyme, circularizing the fragments, and then using primers specific to the P element to amplify the flanking regions.
Step 3: Sequence the PCR product obtained from inverse PCR. This will reveal the DNA sequence adjacent to the P element insertion site.
Step 4: Use bioinformatics tools to compare the sequenced DNA to the Drosophila genome database. This will help identify the gene or genomic region adjacent to the enhancer trap insertion site.
Step 5: Validate the identified gene by analyzing its expression pattern in the wing imaginal disc using techniques such as RNA in situ hybridization or reporter assays to confirm its association with the enhancer trap activity.

비슷한 문제에 대한 검증된 영상 답변:

이 영상 해법은 위 문제에 도움이 된다고 튜터들이 추천한 것입니다.
영상 길이:
4m
도움이 되었나요?

주요 개념

질문에 올바르게 답하기 위해 반드시 이해해야 하는 핵심 개념들은 다음과 같습니다.

Enhancer Trap

An enhancer trap is a genetic tool used to study gene expression by inserting a reporter gene into the genome. This insertion allows researchers to identify and visualize the activity of nearby enhancers, which are regulatory DNA sequences that increase the likelihood of transcription of specific genes. In Drosophila, enhancer traps can reveal spatial and temporal patterns of gene expression, particularly in developmental contexts like the wing imaginal disc.
추천 영상:
가이드 코스
03:21
Alternative trp regulation

P Element Transposition

P element transposition refers to the movement of P elements, which are a type of transposable element, within the Drosophila genome. These elements can insert themselves into various locations, including near genes, and can disrupt or modify gene function. Understanding P element transposition is crucial for identifying the genetic context of enhancer traps, as the location of the insertion can provide insights into the regulation of adjacent genes.
추천 영상:
가이드 코스
03:08
Drosophila P Element

Gene Mapping Techniques

Gene mapping techniques are methods used to determine the location of genes on chromosomes. In the context of identifying the gene adjacent to an enhancer trap insertion, techniques such as PCR amplification, sequencing, and in situ hybridization can be employed. These methods help researchers pinpoint the exact location of the enhancer trap and the nearby genes, facilitating the study of their functions and interactions in developmental processes.
추천 영상:
관련 실천
교과서 질문

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.

How will you determine where and when the mouse genes are expressed?

421
views
교과서 질문

Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?

514
views
교과서 질문

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How would you show that the expression pattern of the enhancer trap line reflects the endogenous gene expression pattern of the adjacent gene?

572
views
교과서 질문

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.

How will you create loss-of-function alleles of the mouse genes?

402
views
교과서 질문

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.

How will you determine whether the mouse genes have redundant functions?

544
views
교과서 질문

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC

650
views