Skip to main content
Ch. 15 - Recombinant DNA Technology and Its Applications
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172당신이 사용하는 게 아니라요?교과서 변경
15장, 문제 27b

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.
How would you show that the expression pattern of the enhancer trap line reflects the endogenous gene expression pattern of the adjacent gene?

검증된 단계별 안내
1
Understand the problem: The goal is to determine whether the expression pattern of the enhancer trap line (a marker gene) matches the endogenous expression pattern of the adjacent gene. Enhancer traps are used to study gene regulation by inserting a reporter gene near regulatory elements, such as enhancers, to observe their activity.
Step 1: Identify the adjacent gene. Use molecular techniques such as inverse PCR or genome sequencing to determine the genomic location of the P element insertion and identify the gene adjacent to the enhancer trap.
Step 2: Analyze the expression pattern of the adjacent gene. Perform RNA in situ hybridization or immunohistochemistry on the wing imaginal disc to visualize the endogenous expression pattern of the adjacent gene. This will provide a direct comparison to the enhancer trap expression pattern.
Step 3: Compare the expression patterns. Overlay the expression pattern of the enhancer trap (e.g., GFP or LacZ reporter) with the endogenous expression pattern of the adjacent gene. Ensure that the spatial and temporal patterns match in the wing imaginal disc.
Step 4: Validate the enhancer's role. To confirm that the enhancer near the P element insertion drives the observed expression, use CRISPR/Cas9 or other genetic tools to delete or mutate the enhancer region. Observe whether the expression of the adjacent gene and the enhancer trap reporter is altered in the wing imaginal disc.

비슷한 문제에 대한 검증된 영상 답변:

이 영상 해법은 위 문제에 도움이 된다고 튜터들이 추천한 것입니다.
영상 길이:
3m

주요 개념

질문에 올바르게 답하기 위해 반드시 이해해야 하는 핵심 개념들은 다음과 같습니다.

Enhancer Traps

Enhancer traps are genetic tools used to study gene expression patterns by inserting a reporter gene into the genome. This reporter gene is activated by nearby enhancers, allowing researchers to visualize where and when specific genes are expressed. In Drosophila, enhancer traps can help identify regulatory elements that control gene expression in specific tissues, such as the wing imaginal disc.
추천 영상:
가이드 코스
03:21
Alternative trp regulation

Gene Expression Patterns

Gene expression patterns refer to the spatial and temporal expression of genes within an organism. These patterns are crucial for understanding how genes contribute to development and function in specific tissues. By comparing the expression of the enhancer trap marker with the expression of the adjacent endogenous gene, researchers can determine if the enhancer trap accurately reflects the natural expression pattern of that gene.
추천 영상:
가이드 코스
02:09
Penetrance and Expressivity

In Situ Hybridization

In situ hybridization is a technique used to detect specific RNA sequences within fixed tissues or cells. This method allows researchers to visualize the localization of gene expression at the cellular level. By applying in situ hybridization to both the enhancer trap line and the adjacent gene, one can compare their expression patterns directly, providing evidence that the enhancer trap reflects the endogenous gene's expression.
추천 영상:
가이드 코스
03:08
Drosophila P Element
관련 실천
교과서 질문

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What is the height potential of the F₁ progeny of the homozygous plants identified in (a) and (b) of this problem?

483
views
교과서 질문

Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?

514
views
교과서 질문

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How can you identify the gene adjacent to the insertion site of the enhancer trap?

573
views
교과서 질문

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.

How will you create loss-of-function alleles of the mouse genes?

402
views
교과서 질문

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.

How will you determine whether the mouse genes have redundant functions?

544
views
교과서 질문

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC

650
views