검증된 단계별 안내
04:55
04:55
08:16You have isolated a gene that is important for the production of milk and wish to study its regulation. You examine the genomes of human, mouse, dog, chicken, pufferfish, and yeast and note that all genomes except yeast have an orthologous gene.
What does the existence of orthologous genes in chicken and pufferfish tell you about the function of this gene?
Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.
For gene X, no gene duplications have occurred in any lineage, and each gene X is derived from the ancestral gene X via speciation events. Are genes AX, BX, and CX orthologous, paralogous, or homologous?
In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.
5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'
5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'
5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'
5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'
5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'
5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'
Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.
Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.
For gene Y, a gene duplication occurred in the lineage leading to A after it diverged from that, leading to B and C. Are genes AY1 and AY2 orthologous or paralogous? Are genes AY1 and BY orthologous or paralogous? Are genes BY and CY orthologous or paralogous?
You have isolated a gene that is important for the production of milk and wish to study its regulation. You examine the genomes of human, mouse, dog, chicken, pufferfish, and yeast and note that all genomes except yeast have an orthologous gene.
How would you identify the regulatory elements important for the expression of your isolated gene in mammary glands?
When the human genome is examined, the chromosomes appear to have undergone only minimal rearrangement in the 100 million years since the last common ancestor of eutherian mammals. However, when individual humans are examined or when the human genome is compared with that of chimpanzees, a large number of small indels and SNPs can be detected. How are these observations reconciled?
