Skip to main content
Ch. 16 - Genomics: Genetics from a Whole-Genome Perspective
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172당신이 사용하는 게 아니라요?교과서 변경
16장, 문제 16a

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.
For gene X, no gene duplications have occurred in any lineage, and each gene X is derived from the ancestral gene X via speciation events. Are genes AX, BX, and CX orthologous, paralogous, or homologous?

검증된 단계별 안내
1
Understand the definitions of orthologous, paralogous, and homologous genes: Orthologous genes are genes in different species that evolved from a common ancestral gene through speciation. Paralogs are genes related by duplication within a genome. Homologous genes are genes that share a common ancestry, which includes both orthologs and paralogs.
Analyze the phylogenetic tree: The problem states that species A, B, and C share a common ancestor, and the lineage leading to species A diverged before the divergence of species B and C. This indicates that the genes AX, BX, and CX are derived from the same ancestral gene X through speciation events.
Determine if gene duplications occurred: The problem explicitly states that no gene duplications have occurred in any lineage. This means that the genes AX, BX, and CX are not paralogous, as paralogs arise from gene duplication events.
Assess the relationship between the genes: Since AX, BX, and CX are derived from the same ancestral gene X through speciation events, they are orthologous. Orthologous genes are a subset of homologous genes, so they are also homologous.
Conclude the classification: Based on the analysis, genes AX, BX, and CX are orthologous because they are derived from the same ancestral gene through speciation events without any gene duplication.

비슷한 문제에 대한 검증된 영상 답변:

이 영상 해법은 위 문제에 도움이 된다고 튜터들이 추천한 것입니다.
영상 길이:
2m
도움이 되었나요?

주요 개념

질문에 올바르게 답하기 위해 반드시 이해해야 하는 핵심 개념들은 다음과 같습니다.

Orthologs

Orthologs are genes in different species that evolved from a common ancestral gene through speciation. They typically retain the same function across species, making them crucial for understanding evolutionary relationships. In the context of species A, B, and C, genes AX, BX, and CX are considered orthologous because they originated from the same ancestral gene X before the species diverged.
추천 영상:

Paralogs

Paralogs are genes that arise from gene duplication events within the same species. They can evolve new functions or retain similar functions over time. In this scenario, since the question specifies that no gene duplications have occurred in any lineage, the concept of paralogs is not applicable to genes AX, BX, and CX.
추천 영상:

Homologs

Homologs refer to genes that share a common ancestry, which includes both orthologs and paralogs. While homologous genes can be found within the same species (paralogs) or across different species (orthologs), the distinction is important for evolutionary studies. In this case, genes AX, BX, and CX are homologous because they all derive from the ancestral gene X, despite being orthologs specifically due to their divergence in different species.
추천 영상:
가이드 코스
03:51
Recombination after Single Strand Breaks
관련 실천
교과서 질문

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The recommended treatment for those with the condition.

447
views
교과서 질문

You have isolated a gene that is important for the production of milk and wish to study its regulation. You examine the genomes of human, mouse, dog, chicken, pufferfish, and yeast and note that all genomes except yeast have an orthologous gene.

What does the existence of orthologous genes in chicken and pufferfish tell you about the function of this gene?

439
views
교과서 질문

In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.

5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'

5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'

5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'

Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.

486
views
교과서 질문

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.

For gene Y, a gene duplication occurred in the lineage leading to A after it diverged from that, leading to B and C. Are genes AY1 and AY2 orthologous or paralogous? Are genes AY1 and BY orthologous or paralogous? Are genes BY and CY orthologous or paralogous?

438
views
교과서 질문

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The anticipated outcome if treatment is applied

511
views
교과서 질문

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.

For gene Z, gene duplications have occurred in all species. Define orthology and paralogy relationships for the different Z genes.

381
views