$$3'\text{AACGTAATGCGGTACCTGTAAGGCA}\ 5'$$

Question 1

Which of the following best describes the structure of a bacterial chromosome?

Accepted Answer

A circular DNA molecule containing essential genes for cell function

Question 2

During DNA replication, which enzyme is responsible for adding nucleotides to the growing daughter strand?

Accepted Answer

DNA polymerase

Question 3

If a DNA sequence is $$5'	ext{TTGCATTACGCCATGGACATTCCGT}\ 3'$$, what is the complementary strand produced during replication?

Accepted Answer

$$3'	ext{AACGTAATGCGGTACCTGTAAGGCA}\ 5'$$

Question 4

Which of the following statements about the lac operon is TRUE?

Accepted Answer

The lac operon is induced when lactose is present and glucose is absent

Question 5

A mutation changes a codon from $$	ext{UAC} ($$tyrosine) to $$	ext{UAA} ($$stop). What type of mutation is this?

Accepted Answer

Nonsense mutation

Question 6

Which mechanism of horizontal gene transfer requires direct cell-to-cell contact and the presence of an F plasmid?

Accepted Answer

Conjugation

Question 7

What is the role of the operator in an operon?

Accepted Answer

It is the site where a repressor protein may bind to regulate transcription

Question 8

Which of the following best describes a frameshift mutation?

Accepted Answer

A mutation caused by insertion or deletion of nucleotides, altering the reading frame

Question 9

In the trp operon, what happens when excess tryptophan is present in the cell?

Accepted Answer

Tryptophan acts as a corepressor, activating the repressor and turning the operon off

Question 10

Which of the following is NOT a product of transcription?

Accepted Answer

DNA polymerase

Question 11

A bacterial cell acquires antibiotic resistance through the uptake of naked DNA from its environment. Which mechanism is responsible?

Accepted Answer

Transformation

Question 12

Which of the following statements about plasmids is TRUE?

Accepted Answer

Plasmids are circular, extrachromosomal DNA molecules that may carry antibiotic resistance genes

Question 13

What is the effect of a silent mutation on the protein product?

Accepted Answer

It has no effect on the amino acid sequence

Question 14

Which of the following best describes the relationship between glucose and cAMP in E. coli?

Accepted Answer

As glucose levels decrease, cAMP levels increase

Question 15

A segment of mRNA has the sequence $$	ext{AUGCGUUAUUGA}. $$Using the genetic code table, what is the corresponding amino acid sequence?

Accepted Answer

Met-Arg-Tyr-Stop

Question 16

Which of the following is a consequence of a missense mutation?

Accepted Answer

One amino acid is substituted for another in the protein

Question 17

Which enzyme is responsible for synthesizing RNA during transcription?

Accepted Answer

RNA polymerase

Question 18

Which of the following is an example of vertical gene transfer?

Accepted Answer

Transfer of genes from a parent cell to daughter cells during cell division

Question 19

Which of the following is TRUE about the semiconservative model of DNA replication?

Accepted Answer

Each new DNA molecule consists of one parental strand and one newly synthesized strand

Microbial Genetics: Structure, Expression, Regulation, and Horizontal Gene Transfer

Study Guide - Practice Questions