Question 1

Which of the following best describes semiconservative replication of DNA in prokaryotes?

Accepted Answer

Each daughter DNA molecule consists of one parental and one newly synthesized strand.

Question 2

During the initiation of DNA synthesis in bacteria, which structure forms at the origin of replication and what is its significance?

Accepted Answer

Theta structure; it allows bidirectional replication from a single origin.

Question 3

Which of the following is an example of an essential non-protein-coding DNA sequence in prokaryotes, and why is it essential?

Accepted Answer

Origin of replication; it is required to initiate DNA synthesis.

Question 4

What is the primary function of the protein DNA gyrase in prokaryotic cells?

Accepted Answer

To introduce negative supercoils into DNA, relieving torsional strain during replication.

Question 5

Which statement best explains why GC-rich DNA requires a higher temperature to denature than AT-rich DNA?

Accepted Answer

GC pairs form three hydrogen bonds, while AT pairs form only two.

Question 6

Which of the following best describes the role of sigma factors in bacterial RNA synthesis?

Accepted Answer

They direct RNA polymerase to specific promoter sequences to initiate transcription.

Question 7

How do prokaryotes typically terminate RNA transcription?

Accepted Answer

By either rho-dependent or rho-independent mechanisms.

Question 8

Why can it be problematic to express bacterial genes in eukaryotic cells?

Accepted Answer

Bacterial genes often lack introns and eukaryotic promoters, leading to inefficient expression.

Question 9

Which of the following statements is FALSE? 'Proteins are the only biomolecules capable of catalyzing bond formation.'

Accepted Answer

FALSE; some RNA molecules (ribozymes) can also catalyze bond formation.

Question 10

How is an open reading frame (ORF) identified in a DNA sequence?

Accepted Answer

By locating a start codon (AUG) and a stop codon in the same reading frame.

Question 11

Why is the half-life of mRNA generally much shorter than that of rRNA and tRNA in bacteria?

Accepted Answer

mRNA is rapidly degraded to allow quick changes in gene expression.

Question 12

A circular DNA molecule isolated from a bacterium contains genes for capsule formation, pili, antibiotic resistance, and an origin of replication. What is this genetic element?

Accepted Answer

A plasmid; it is an extrachromosomal DNA element that can replicate independently.

Question 13

According to the Central Dogma of molecular biology, what is the basic flow of genetic information?

Accepted Answer

$$DNA \rightarrow RNA \rightarrow Protein$$

Question 14

Given the DNA sense strand 3ʹ–A T A T T A C C A G G C A T G G A C C C C C G G G–5ʹ, what is the corresponding mRNA sequence?

Accepted Answer

$$5'	ext{GCCCGGGGUCCAUGCCUGGUAAUAU}3'$$

Question 15

What is the principle of bidirectional replication in prokaryotes?

Accepted Answer

Replication proceeds in both directions from the origin, forming two replication forks.

Question 16

Which of the following best describes the composition of the prokaryotic ribosome?

Accepted Answer

It consists of a 30S small subunit and a 50S large subunit, forming a 70S ribosome.

Question 17

Which of the following is a key difference between transcription and translation in bacteria?

Accepted Answer

Transcription synthesizes RNA from DNA, while translation synthesizes protein from mRNA.

Question 18

Why does transcriptional-translational coupling occur in bacteria?

Accepted Answer

Because there is no nuclear membrane, ribosomes can bind to mRNA as it is being transcribed.

Question 19

Given the double-stranded DNA sequence 3’–CCT GCG TAG TGA TAC GTT AAT GCT GCC TTG TC–5’ and 5’–GGA CGC ATC ACT ATG CAA TTA CGA CGG AAC AG–3’, what is the expected mRNA sequence if the bottom strand is the template?

Accepted Answer

$$5'	ext{GGA CGC AUC ACU AUG CAA UUA CGA CGG AAC AG}3'$$

Microbio lecture midterm pt.2

Study Guide - Practice Questions

Study Guide - Flashcards