DNA Methylation and Epigenetic Regulation in Gene Expression

Gene Expression: DNA Methylation

Introduction to DNA Methylation

DNA methylation is a key epigenetic mechanism that regulates gene expression without altering the underlying DNA sequence. It plays a crucial role in development, cellular differentiation, and the maintenance of cellular identity.

• Epigenetics refers to heritable changes in gene function that do not involve changes in the DNA sequence.

• DNA methylation typically involves the addition of a methyl group to the 5' position of cytosine residues, especially within CpG dinucleotides.

• This modification can affect gene expression by altering chromatin structure and accessibility.

Mechanism of DNA Methylation

DNA methylation most commonly occurs at CpG sites, where a cytosine nucleotide is followed by a guanine nucleotide in the DNA sequence.

• CpG islands are regions with a high frequency of CpG sites, often found in gene promoter regions.

• Methylation of CpG islands in promoters is associated with gene silencing.

• Enzymes called DNA methyltransferases (DNMTs) catalyze the transfer of methyl groups to cytosine.

Example: CpG Methylation

Consider the following DNA sequence:

• 5'-CAACGAGG-3'

• 3'-GTTGCTCC-5'

Methylation occurs at the cytosine in the CpG dinucleotide:

• 5'-CCTGTTG-3'

• 3'-GGAGCAAC-5'

Where the red C indicates a methylated cytosine.

DNA Methylation and Gene Inactivation

Methylation of CpG islands within promoter regions leads to the formation of heterochromatin, resulting in gene inactivation.

• Normal chromatin is less methylated and more accessible for transcription.

• Silenced heterochromatin is highly methylated, compact, and transcriptionally inactive.

Chromatin Structure and Methylation

• Histone proteins (H1) help package DNA into chromatin.

• Methylation recruits proteins that promote chromatin condensation.

Maintenance of DNA Methylation Patterns

After DNA replication, methylation patterns are preserved by maintenance DNA methyltransferases.

• Newly synthesized DNA strands are initially unmethylated.

• Maintenance DNMTs recognize hemimethylated DNA and restore methylation on the new strand.

Example DNA sequence after replication:

• Original: ATCGTGACCACTACGTAGGCATAGALGATARCCACATTGEGT TAGCACTGGTGATGCATCCGTATCTGCTATTGOTGTAACGCA

• After replication, methyl groups are added to the new strand to match the parent strand.

Detection of DNA Methylation

Methylation-sensitive restriction enzymes are used to distinguish between methylated and unmethylated CpG sites.

• HpaII and MspI are restriction enzymes that recognize the same DNA sequence but differ in sensitivity to methylation.

• HpaII cannot cut methylated DNA, while MspI can cut regardless of methylation status.

Enzyme	Methylation Status	Fragment Size
HpaII	Unmethylated	400 bp
HpaII	Methylated	800 bp
MspI	Any	400 bp

Epigenetics in Development: The Case of Queen Bees

Epigenetic regulation, including DNA methylation, can lead to phenotypic differences in genetically identical organisms. A classic example is the differentiation between queen bees and worker bees.

• Queen bees and workers are genetically identical but differ in morphology and behavior.

• Diet, specifically the consumption of royal jelly, influences DNA methylation patterns.

• Royal jelly inhibits DNA methyltransferase activity, leading to the activation of 'queen genes'.

Example: Royal Jelly and Queen Development

• Queens are raised in special cells ('queen cups') and fed royal jelly.

• Royal jelly shuts off one of the methyltransferases, allowing queen-specific gene expression.

Summary Table: Key Features of DNA Methylation

Feature	Description
Location	CpG islands, especially in promoters
Enzyme	DNA methyltransferase (DNMT)
Effect	Gene silencing, chromatin condensation
Detection	Methylation-sensitive restriction enzymes
Biological Example	Queen bee development via royal jelly

Key Equations and Concepts

• Methylation Reaction:

$ext{Cytosine} + ext{S-adenosylmethionine} ightarrow 5 ext{-methylcytosine} + ext{S-adenosylhomocysteine}$

• Maintenance of Methylation:

$ext{DNMT}_{ ext{maintenance}}: ext{hemimethylated DNA} ightarrow ext{fully methylated DNA}$

Additional info:

• DNA methylation is reversible and can be dynamically regulated in response to environmental factors.

• Aberrant DNA methylation is implicated in various diseases, including cancer.