Q: Given the DNA sequence $3'\text{-}ATCGGCAGGACCTTAAAT\text{-}5'$ and $5'\text{-}TAGCCGTCCTGGAATTTA\text{-}3'$, which of the following is the correct mRNA sequence produced from transcription?

$3'\text{-}AUCGGCAGGACCUUAAAU\text{-}5'$

Question 1

Which of the following best describes the function of the regulatory region of a gene?

Accepted Answer

It contains binding sites for RNA polymerase and controls when transcription begins.

Question 2

During transcription, which of the following statements is TRUE regarding the strands of DNA?

Accepted Answer

Only one of the two DNA strands is used as a template to synthesize RNA.

Question 3

Given the DNA sequence $3'	ext{-}ATCGGCAGGACCTTAAAT	ext{-}5'$ and $5'	ext{-}TAGCCGTCCTGGAATTTA	ext{-}3'$, which of the following is the correct mRNA sequence produced from transcription?

Accepted Answer

$3'	ext{-}AUCGGCAGGACCUUAAAU	ext{-}5'$

Question 4

Which of the following best describes the role of tRNA during translation?

Accepted Answer

tRNA brings specific amino acids to the ribosome and matches its anticodon to the codon on mRNA.

Question 5

A segment of mRNA reads $5'	ext{-}CACGGUCGAUGAGGUUACAUCGC	ext{-}3'$. If translation begins at the first AUG, what is the correct amino acid sequence?

Accepted Answer

Met-Arg-Leu-His-Arg

Question 6

Which of the following statements about the genetic code is correct?

Accepted Answer

A stop codon signals the end of translation.

Question 7

A mutation changes a codon from UAU (tyrosine) to UAA (stop). What type of mutation is this?

Accepted Answer

Nonsense mutation

Question 8

A patient is infected with a flu virus strain whose HA gene RNA sequence differs from the typical strain by a single nucleotide, resulting in a single amino acid change in the protein. What type of mutation is this?

Accepted Answer

Missense mutation

Question 9

If a mutation in the HA gene introduces a premature stop codon, what is the most likely effect on the HA protein?

Accepted Answer

The protein will be too short.

Question 10

A frameshift mutation occurs in the coding region of a gene. Which of the following best describes the likely outcome?

Accepted Answer

The reading frame will be altered, potentially changing many amino acids and possibly introducing a premature stop codon.

Question 11

Which of the following best explains why not all mutations in the coding region of a gene result in a change in the protein sequence?

Accepted Answer

The genetic code is degenerate, so some codons code for the same amino acid.

Question 12

A researcher finds that a new flu strain's HA protein is identical in length and sequence to the typical strain, despite a nucleotide change in the gene. What type of mutation most likely occurred?

Accepted Answer

Silent mutation

Question 13

Which of the following is the correct sequence of events in gene expression?

Accepted Answer

Transcription → Translation → Protein folding

Question 14

A DNA sequence is mutated such that an extra base is inserted early in the coding region. What is the most likely effect on the resulting protein?

Accepted Answer

The protein will have a completely different sequence after the mutation site and may be truncated.

Question 15

Which of the following best describes the role of the promoter in transcription?

Accepted Answer

It is the site where RNA polymerase binds to initiate transcription.

Question 16

A patient is infected with a flu virus strain whose HA gene has a mutation that does not change the amino acid sequence of the protein. Which of the following best describes this mutation?

Accepted Answer

Silent mutation

Question 17

If a gene's coding region is 3000 base pairs long, how many amino acids could the resulting protein contain, assuming no introns or stop codons within the sequence?

Accepted Answer

$1000$

Question 18

Which of the following is a real-world consequence of a nonsense mutation in a viral gene such as HA?

Accepted Answer

The virus may produce a nonfunctional protein, potentially reducing its ability to infect hosts.

Question 19

A flu virus strain is found to have a frameshift mutation in the HA gene. Which of the following is the most likely effect on the protein product?

Accepted Answer

The protein will have a different amino acid sequence after the mutation and may be truncated.

Question 20

A new flu strain is identified with a single nucleotide substitution in the HA gene, resulting in a stop codon. What is the most likely effect on the HA protein?

Accepted Answer

The protein will be too short due to premature termination.

Genetic Mechanisms in Influenza: Case Study and Molecular Basis

Study Guide - Practice Questions

Study Guide - Flashcards