BackProkaryotic Transcription: Mechanisms, Regulation, and Comparison with Replication
Study Guide - Smart Notes
Tailored notes based on your materials, expanded with key definitions, examples, and context.
Prokaryotic Transcription
Overview of Transcription
Transcription is the process by which genetic information encoded in DNA is copied into RNA. In prokaryotes, this process is tightly regulated and essential for gene expression.
Definition: Transcription is the synthesis of RNA from a DNA template by RNA polymerase.
Location: In prokaryotes, transcription occurs in the cytoplasm, as there is no nuclear membrane.
Key Enzyme: RNA polymerase catalyzes the formation of RNA from ribonucleotides.
Replication vs. Transcription
Comparison of DNA Replication and Transcription
Both replication and transcription involve copying genetic information, but they serve different purposes and have distinct outcomes.
Replication:
Produces a DNA copy from one DNA template.
The copy is permanent and can be passed on to future generations.
Ensures genetic continuity during cell division.
Transcription:
Produces many RNA copies from one DNA template.
RNA copies are transient and are eventually degraded.
Not passed on to future generations; used for gene expression in the current cell.
Example: A single mammalian cell contains about 300,000 mRNA molecules, with individual mRNAs varying in abundance. Some mRNAs are rare and may account for less than 0.1% of the total mRNA pool.
Gene Expression Control
Levels of Regulation
Gene expression is regulated at multiple steps, ensuring precise control over protein production.
Transcriptional control: Determines whether a gene is transcribed into RNA.
RNA processing control: Modifies the primary RNA transcript (e.g., splicing, capping).
mRNA transport and localization control: Regulates movement of mRNA from nucleus to cytoplasm (in eukaryotes).
mRNA degradation control: Determines the stability and lifespan of mRNA molecules.
Translational control: Regulates the efficiency and rate at which mRNA is translated into protein.
Protein activity control: Modifies protein function after translation (e.g., phosphorylation).
Protein degradation control: Determines the lifespan of proteins in the cell.
Example: mRNA degradation and protein activity are key regulatory points for controlling gene expression levels.
DNA Duplex and Transcription
Template and Coding Strands
During transcription, only one strand of the DNA duplex is used as a template for RNA synthesis.
Non-template (coding) strand: Has the same sequence as the mRNA (except T is replaced by U in RNA).
Template strand: Complementary to the mRNA; used by RNA polymerase to synthesize RNA.
Directionality: The coding (sense) strand is written 5' to 3'. The template strand is read 3' to 5' by RNA polymerase, and RNA is synthesized 5' to 3'.
Example:
DNA coding strand: 5' TACGCGTACGGCATGCAATGCATGCTAGTGA 3'
DNA template strand: 3' ATGCGCATGCCGTACGTTACGTACGATCACT 5'
mRNA: 5' UACGCGUACGGCAUGCAAUGCAUGCUAGUGA 3'
Structure of a Gene
Gene Anatomy
A typical gene contains several functional regions that regulate its expression and encode protein products.
Promoter: DNA sequence where RNA polymerase and transcription factors bind to initiate transcription.
Transcription start site (+1): The first nucleotide transcribed into RNA.
5' Untranslated Region (5' UTR): Sequence between the transcription start site and the start codon; not translated into protein.
Open Reading Frame (ORF): The protein-coding region, starting with a start codon and ending with a stop codon.
3' Untranslated Region (3' UTR): Sequence following the stop codon; not translated but may regulate mRNA stability and translation.
Polyadenylation site: Signals addition of a poly(A) tail to the mRNA (mainly in eukaryotes).
Transcription terminator: Sequence that signals the end of transcription.
Monocistronic vs. Polycistronic mRNA
Types of mRNA Molecules
Monocistronic mRNA: Contains a single open reading frame (ORF); typical in eukaryotes.
Polycistronic mRNA: Contains multiple ORFs; common in prokaryotes, allowing coordinated expression of related genes (operons).
Example: The lac operon in E. coli produces a polycistronic mRNA encoding several enzymes for lactose metabolism.
Transcription Initiation in Prokaryotes
Promoter Recognition and Sigma Factors
Initiation of transcription requires recognition of promoter sequences by RNA polymerase and associated sigma factors.
Promoter: Specific DNA sequence upstream of the gene where RNA polymerase binds.
Sigma factor (σ): A protein subunit that directs RNA polymerase to specific promoter sequences, increasing binding specificity.
Consensus sequences: Conserved DNA motifs in promoters, such as the -10 (Pribnow box/TATA box) and -35 elements in prokaryotes.
Example: The consensus sequence for the -10 region is typically TATAAT, and for the -35 region is TTGACA in E. coli promoters.
Steps of Transcription Initiation
Closed complex formation: RNA polymerase holoenzyme binds to the promoter; DNA remains double-stranded.
Open complex formation: DNA unwinds near the -10 region, exposing the template strand.
Abortive initiation: Short RNA fragments are synthesized and released until RNA polymerase escapes the promoter.
Promoter clearance: RNA polymerase moves beyond the promoter, entering the elongation phase.
Transcription Elongation and Termination
Elongation
During elongation, RNA polymerase synthesizes RNA by adding ribonucleotides complementary to the DNA template strand.
RNA is synthesized in the 5' to 3' direction.
Multiple RNA polymerases can transcribe a gene simultaneously.
Proofreading occurs, but is less stringent than in DNA replication.
Termination
Transcription ends when RNA polymerase encounters a terminator sequence.
Intrinsic (Rho-independent) termination: Relies on formation of a GC-rich hairpin loop in the RNA followed by a stretch of U residues, causing RNA polymerase to dissociate.
Rho-dependent termination: Requires the Rho protein, which binds to the RNA and uses helicase activity to release the RNA transcript from the DNA template.
Key Terms and Definitions
Promoter: DNA region where transcription begins.
Operator: DNA segment that regulatory proteins bind to, controlling gene expression (mainly in prokaryotes).
Silencer: DNA element that represses transcription when bound by specific proteins.
Consensus sequence: The most common sequence found at a particular position in a set of similar DNA or RNA sequences.
Open reading frame (ORF): The part of a gene that encodes a protein.
Sigma factor: A protein that enables RNA polymerase to recognize specific promoter sequences.
Table: Comparison of Replication and Transcription
Feature | Replication | Transcription |
|---|---|---|
Template | DNA | DNA |
Product | DNA | RNA |
Enzyme | DNA polymerase | RNA polymerase |
Direction of synthesis | 5' to 3' | 5' to 3' |
Primer required? | Yes | No |
Proofreading | High fidelity | Lower fidelity |
Purpose | Genetic inheritance | Gene expression |
Formulas and Equations
Directionality of transcription:
Base pairing during transcription:
Additional info:
Some content was inferred and expanded for clarity and completeness, such as the detailed steps of transcription initiation and the table comparing replication and transcription.
Specific examples (e.g., lac operon, consensus sequences) were added for academic context.