Transcription and mRNA Processing in Prokaryotes and Eukaryotes

Study Guide - Smart Notes

Tailored notes based on your materials, expanded with key definitions, examples, and context.

Central Dogma of Genetics

Overview

The central dogma of genetics describes the flow of genetic information within a biological system: DNA is transcribed into RNA, which is then translated into protein. This process is fundamental to gene expression and cellular function.

DNA serves as the template for RNA synthesis.
RNA is processed and translated into proteins in the ribosome.
Proteins carry out cellular functions and determine phenotype.

Comparison of DNA and RNA structure and bases

Transcription: Basic Steps

Stages of Transcription

Transcription is the process by which RNA is synthesized from a DNA template. It consists of four main steps:

Binding of RNA polymerase and other factors: RNA polymerase attaches to the promoter region of DNA.
Initiation: The enzyme unwinds DNA and begins RNA synthesis.
Elongation: RNA polymerase adds nucleotides to the growing RNA strand in the 5’ to 3’ direction.
Release: The RNA transcript is released once a termination signal is reached.

Template binding and initiation of transcription

Transcription Machinery and Components

Key Elements

Several components are required for transcription:

Ribonucleoside triphosphates: Building blocks of RNA, containing uracil instead of thymine.
RNA polymerase: Enzyme responsible for synthesizing RNA.
Transcription factors: Proteins that regulate the binding and activity of RNA polymerase.
Promoters, enhancers, silencers: DNA sequences that regulate transcription initiation and rate.

Structure of RNA polymerase holoenzyme

Transcription vs Replication

Comparison

Transcription and DNA replication share similarities but also have distinct differences:

Both use nucleoside triphosphates and form phosphodiester bonds.
RNA polymerase can initiate synthesis without a primer, unlike DNA polymerase.
Only one DNA strand is transcribed at a time.

Comparison of DNA and RNA structure and bases

Prokaryotic Transcription

RNA Polymerase and Sigma Factor

In prokaryotes, a single RNA polymerase holoenzyme (composed of six subunits) carries out transcription. The sigma factor is a specialized transcription factor required for promoter recognition and initiation.

Holoenzyme: Biochemically active form of RNA polymerase.
Sigma factor: Necessary for binding to the promoter; dissociates after initiation.

Chain elongation and sigma factor dissociation

Promoter Regions: TATA Box

The TATA box is a conserved DNA sequence motif found in many prokaryotic and eukaryotic promoters. It is essential for transcription initiation.

Located approximately 10-30 bp upstream of the transcription start site.
Recognized by transcription factors and RNA polymerase.

Prokaryotic TATA box sequence alignment Eukaryotic TATA box sequence alignment

Transcription Termination in Prokaryotes

Transcription ends when RNA polymerase encounters a termination sequence, often resulting in a hairpin loop formation in the RNA.

Termination sequence causes the RNA to kink and base-pair with itself.
Hairpin loop signals the release of the RNA transcript.

Inverted repeats at termination sites Hairpin structure at mRNA terminus

Prokaryotic mRNA: Polycistronic Transcripts

Structure and Function

Prokaryotic mRNA is often polycistronic, meaning it contains multiple open reading frames (ORFs) corresponding to different genes.

Open Reading Frame (ORF): DNA sequence transcribed into mRNA, flanked by start and stop codons.
Each ORF produces a distinct protein product.

Linear transcription from circular DNA Polycistronic mRNA structure

Eukaryotic Transcription

RNA Polymerase II and General Transcription Factors

Eukaryotic transcription is more complex, requiring multiple general transcription factors (GTFs) for proper initiation.

TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH: Each has a specific role in stabilizing, recruiting, and activating RNA polymerase II.
Chromatin structure affects accessibility of DNA for transcription.

Formation of pre-initiation complex in eukaryotes

Chromatin Structure and Gene Regulation

Chromatin can exist in open (active) or closed (repressed) states, influencing transcriptional activity.

Transcription factors can open chromatin, making genes accessible.
Genes on different chromosomes may associate based on transcriptional state.

Chromatin states: open vs closed

Eukaryotic Gene Regulation at Transcription Initiation

Basal vs Activated Transcription

Basal transcription: Low-level expression from the core promoter (TATA box) via GTFs.
Activated transcription: Enhanced expression via additional transcription factors binding to regulatory promoters and enhancers.

Sticky note analogy for basal transcription Billboard analogy for activated transcription DNA looping for enhancer activation

Transcription Factors: Activation and Repression

Trans-acting Factors

Transcription factors can act on any DNA molecule, not just the chromosome where they are encoded.

Some transcription factors activate transcription by opening chromatin and recruiting RNA polymerase.
Others repress transcription by binding to DNA and shutting down gene expression.

Chromatin states: open vs closed Transcription factors can repress transcription

mRNA Processing in Eukaryotes

Pre-mRNA Modifications

Eukaryotic pre-mRNA undergoes three main processing steps before becoming mature mRNA:

5’ Modification: Addition of a G-cap (modified guanosine) for ribosome loading.
3’ Modification: Addition of a poly-A tail (100-250 adenosines) for transcript stability and export.
Splicing: Removal of introns and joining of exons by the spliceosome complex.

Structure of the 5' cap Poly-A tail addition Splicing of pre-mRNA Lariat formation and exon ligation

Exons and Introns

Definitions and Significance

Exons: Coding sequences retained in mature mRNA.
Introns: Non-coding sequences removed during splicing.
Splicing is mediated by the spliceosome, a complex of proteins and snRNAs.

Exons and introns in mRNA

Translation: From mRNA to Protein

Ribosome Structure and Function

Translation occurs in the ribosome, where mRNA is read and tRNA brings amino acids to build the protein chain.

Ribosome consists of a large (50S) and small (30S) subunit in prokaryotes.
tRNA matches codons in mRNA with the correct amino acid.
Proteins are synthesized as the ribosome moves along the mRNA.

Ribosome structure and translation Ribosome subunits and translation process

Practice: Central Dogma in Action

Example Conversion

Given a DNA sequence, create the complementary strand.
Transcribe the template strand to mRNA.
Translate mRNA to protein using the genetic code.

Step	Sequence
DNA (5' - 3')	CCGATTACATGCACAGCTCAGGAATCGAATGAACTGA
Complementary DNA (3' - 5')	GGCTAATGTACGTGTCGAGTCCTTAGCTTACTTGACT
mRNA (5' - 3')	CCGAUUACAUGCACAGCUCAGGAAUCGAAUGAACUGA
Protein	MET HIS SER SER GLY ILE GLU

Genetic code table for translation

Summary Table: Key Differences in Transcription

Feature	Prokaryotes	Eukaryotes
RNA Polymerase	Single holoenzyme	Multiple types (I, II, III)
Promoter Recognition	Sigma factor	General transcription factors
mRNA Structure	Polycistronic	Monocistronic
mRNA Processing	None	5' cap, poly-A tail, splicing
Chromatin	No chromatin	Chromatin structure regulates access

Conclusion

Understanding transcription and mRNA processing is essential for grasping gene expression and regulation in both prokaryotic and eukaryotic cells. These processes are central to the flow of genetic information and the production of proteins that drive cellular function.