Q: A DNA fragment is 20 nucleotides long and contains 8 G/C pairs and 12 A/T pairs. Using the Wallace Rule, what is the melting temperature ($$T_m) of $$this fragment?

$$T_m = 4 \times 8 + 2 \times 12 = 32 + 24 = 56^\circ C$$

Question 1

Which of the following best describes the primary goal of the Human Genome Project (HGP)?

Accepted Answer

To determine the exact order of base pairs in the entire human genome.

Question 2

Which sequencing method was primarily used by the Human Genome Project to assemble the human genetic code?

Accepted Answer

Hierarchical (BAC-based) shotgun sequencing

Question 3

Why was the identity of the volunteers whose DNA was sequenced in the Human Genome Project intentionally kept unknown?

Accepted Answer

To protect the privacy of the volunteers

Question 4

According to the Supreme Court ruling in 2013, which of the following can be patented?

Accepted Answer

Synthetic genes that have been significantly altered from their natural versions

Question 5

A DNA fragment is 20 nucleotides long and contains 8 G/C pairs and 12 A/T pairs. Using the Wallace Rule, what is the melting temperature ($$T_m) of $$this fragment?

Accepted Answer

$$T_m = 4 	imes 8 + 2 	imes 12 = 32 + 24 = 56^\circ C$$

Question 6

Which of the following is NOT a recommended consideration when designing PCR primers?

Accepted Answer

Primers should have long stretches of a single base to ensure specificity.

Question 7

What is the main advantage of having a GC clamp at the 3’ end of a primer?

Accepted Answer

It increases the stability of primer binding during PCR.

Question 8

Which of the following statements about the public availability of the human genome sequence is TRUE?

Accepted Answer

The sequence data was made publicly available immediately after sequencing.

Question 9

If a DNA sequence is 5’ ATGCGTACGCTAGCTAGCTAGCATGCATGCATGCATGCATGCATGCATGC 3’, which of the following is a correctly written reverse primer (5’→3’)?

Accepted Answer

5’ GCTAGCATGCATGCATGCATGCAT 3’

Question 10

Which of the following best explains why the Human Genome Project had a significant economic impact, as shown in the infographic?

Accepted Answer

It stimulated biotechnology industries, leading to job creation and increased personal income.

Question 11

In the context of genome sequencing, what is the main difference between the hierarchical shotgun approach and the whole-genome shotgun approach?

Accepted Answer

The hierarchical approach involves mapping and ordering large DNA fragments before sequencing, while the whole-genome approach sequences random fragments directly.

Question 12

A primer pair is designed with the following sequences: Forward primer: 5’ ATCGCTAGCTAGCTAGCTAGCATGC 3’, Reverse primer: 5’ GCTAGCATGCATGCATGCATGCAT 3’. What is the length of the DNA segment amplified if the primers bind perfectly to the template?

Accepted Answer

The length is the distance between the 5’ ends of the primers, including both primers.

Question 13

Which of the following is a plausible reason why long stretches of a single nucleotide should be avoided in primer design?

Accepted Answer

They can lead to nonspecific binding and primer-dimer formation.

Question 14

If a primer has the sequence 5’ GCGCGCGCGCGCGCGCGCGC 3’, what is its GC content?

Accepted Answer

$$\frac{20}{20} 	imes 100\% = 100\%$$

Question 15

Which of the following best describes a genome?

Accepted Answer

The complete set of DNA, including all genes, in an organism.

Question 16

A student claims that the Human Genome Project sequenced the genome of a single individual. Is this statement accurate?

Accepted Answer

No, the sequence was derived from the DNA of several volunteers.

Question 17

Which of the following is a direct application of knowing the human genome sequence in medicine?

Accepted Answer

Identifying genetic variants associated with diseases.

Question 18

If a primer has a melting temperature ($$T_m) of$$ $$60^\circ C$$ and another has $$T_m of$$ $$52^\circ C$$, what is the best course of action?

Accepted Answer

Redesign one or both primers so their $$T_m$$ values are more similar.

DNA Sequencing Technologies and Primer Design: Study Notes for Genetics Students

Study Guide - Practice Questions

Study Guide - Flashcards