Question 1

In the serine biosynthesis pathway in Neurospora crassa, which of the following mutants would be able to grow if only 3-phosphoserine is provided in the media?

Accepted Answer

A mutant with no mutations

Question 2

If a single gene encoded all three enzymes in the serine biosynthesis pathway and a loss-of-function mutation occurred in that gene, what would be the expected growth pattern on media containing any of the pathway intermediates?

Accepted Answer

No growth on any intermediates, but growth on serine

Question 3

Which of the following elements is found only on the DNA and not on the mRNA in a typical bacterial protein-coding gene?

Accepted Answer

Promoter

Question 4

In the Meselson and Stahl experiment, if after three generations only two bands are observed—one at the position of pure $$^{14}N$$ and one at pure $$^{15}N$$—which model of DNA replication is supported?

Accepted Answer

Conservative

Question 5

Refer to the lagging strand synthesis diagram. At which positions will DNA ligase seal the phosphodiester backbone after RNA primer removal and DNA synthesis?

Accepted Answer

At positions A and C

Question 6

A family pedigree shows a pattern of breast cancer inheritance. If an affected individual is heterozygous for a BRCA-1 deletion and both parents are unaffected, what is the most likely explanation for the inheritance pattern?

Accepted Answer

Autosomal dominant with incomplete penetrance

Question 7

A deletion mutation in the BRCA-1 gene results in a shorter PCR and Northern blot band, but no protein is detected on the Western blot. What is the most likely effect of this mutation?

Accepted Answer

Deletion of a regulatory or coding region preventing translation

Question 8

Given the following coding-strand DNA sequence, which base change would most likely disrupt transcription initiation?

$$	ext{CAGCCCATCCCTTATAAATTAGCGAACGAGTCACGACTTACTTGCTGACA}$$

Accepted Answer

A to G at position 14 (in the TATA box)

Question 9

A mutation changes the 5' splice site from 'Ggt' to 'Gct' in an intron. What is the most likely consequence?

Accepted Answer

Intron retention in the mRNA

Question 10

You are studying an alien organism with a 3-letter genetic code. If the codon AUA codes for arginine in both of your translation experiments, what can you infer about the genetic code of this organism?

Accepted Answer

It is different from the universal genetic code

Question 11

For the mRNA sequence 5’ GACCAUGAGCGAUAACGGAUAGGCGA 3’, translation begins at the bolded AUG. What is the third amino acid in the resulting polypeptide?

Accepted Answer

Asparagine (Asn)

Question 12

Which of the following terms is a consensus sequence found on prokaryotic mRNA and is important for translation initiation?

Accepted Answer

Shine-Dalgarno sequence

Question 13

Which of the following proteins is directly involved in removing RNA primers during DNA replication in eukaryotes?

Accepted Answer

Flap endonuclease

Question 14

A mutation occurs in the 3' untranslated region (UTR) of a gene, between the stop codon and the polyadenylation signal. What is the most likely effect?

Accepted Answer

No significant effect on gene function

Question 15

Which of the following is a protein complex involved in eukaryotic transcription initiation?

Accepted Answer

TFIIB/TFIID/TFIIE/TFIIF/TFIIH

Question 16

Which of the following is NOT a protein but is essential for translation in both prokaryotes and eukaryotes?

Accepted Answer

Initiator tRNA

Question 17

Which of the following would be the correct tRNA anticodon (5' to 3') for the codon GAU?

Accepted Answer

AUC

Question 18

Which of the following is a consensus sequence found in eukaryotic promoters and is critical for transcription initiation?

Accepted Answer

TATA box

Question 19

Which of the following is a function of the polyA tail in eukaryotic mRNA?

Accepted Answer

Stabilizes mRNA and aids in export from the nucleus

Question 20

Which of the following is a protein involved in the termination of transcription in prokaryotes?

Accepted Answer

Rho protein

Genetics Homework Study Guide: Pathways, Gene Structure, DNA Replication, and Inheritance

Study Guide - Practice Questions

Study Guide - Flashcards