Skip to main content
Ch. 15 - Recombinant DNA Technology and Its Applications
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook
Chapter 15, Problem 29d

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What are the phenotypes and proportions of each phenotype among the F₂?

Verified step by step guidance
1
Step 1: Understand the genetic system described in the problem. Each gene (A, B, and C) has two alleles: a dominant allele (A, B, C) and a recessive allele (a, b, c). Dominant alleles contribute 10 cm to plant height, while recessive alleles contribute 4 cm. The phenotype is determined by the sum of contributions from all three genes.
Step 2: Determine the possible genotypes for each gene in the F₂ generation. Since the F₂ generation results from a dihybrid cross (AaBbCc × AaBbCc), each gene can have the following genotypes: AA, Aa, or aa; BB, Bb, or bb; CC, Cc, or cc. Use a Punnett square to calculate the proportions of each genotype for each gene.
Step 3: Calculate the height contribution for each genotype. For example, AA contributes 10 cm, Aa contributes 10 cm (due to dominance), and aa contributes 4 cm. Repeat this for BB, Bb, bb and CC, Cc, cc. Combine the contributions from all three genes to determine the total height for each genotype combination.
Step 4: Determine the phenotypes based on the total height contributions. For example, a plant with genotype AA BB CC will have a height of 10 cm + 10 cm + 10 cm = 30 cm, while a plant with genotype aa bb cc will have a height of 4 cm + 4 cm + 4 cm = 12 cm. List all possible phenotypes and their corresponding heights.
Step 5: Calculate the proportions of each phenotype among the F₂ generation. Multiply the probabilities of each genotype for the three genes (from the Punnett square) to find the overall proportion of each phenotype. For example, the proportion of AA BB CC is the product of the probabilities of AA, BB, and CC occurring independently.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.
Video duration:
2m

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

Additive Gene Interaction

Additive gene interaction occurs when multiple genes contribute to a single trait, with each gene's alleles having a cumulative effect on the phenotype. In this case, the three genes (A, B, and C) each contribute a specific amount to the plant height, leading to a range of possible heights based on the combination of dominant and recessive alleles.
Recommended video:
Guided course
07:56
Interacting Genes Overview

Dominance and Alleles

Dominance refers to the relationship between alleles, where a dominant allele masks the effect of a recessive allele in a heterozygous genotype. In this scenario, alleles A, B, and C are dominant over their respective recessive alleles (a, b, and c), influencing the phenotype of the plants based on which alleles are present.
Recommended video:
Guided course
04:37
Variations on Dominance

Phenotypic Ratios in F₂ Generation

The F₂ generation results from crossing two F₁ individuals, leading to a variety of genotypes and phenotypes. The phenotypic ratios can be predicted using a Punnett square or by applying the principles of Mendelian inheritance, which helps determine the proportions of each phenotype based on the combinations of dominant and recessive alleles from the parental generation.
Recommended video:
Guided course
10:48
Mutations and Phenotypes
Related Practice
Textbook Question

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What is the height potential of the F₁ progeny of the homozygous plants identified in (a) and (b) of this problem?

483
views
Textbook Question

You have cloned a gene for an enzyme that degrades lipids in a bacterium that normally lives in cold temperatures. You wish to transfer this gene into E. coli to produce industrial amounts of enzyme for use in laundry detergent.

How would you accomplish this?

494
views
Textbook Question

Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?

514
views
Textbook Question

The RAS gene encodes a signaling protein that hydrolyzes GTP to GDP. When bound by GDP, the RAS protein is inactive, whereas when bound by GTP, RAS protein activates a target protein, resulting in stimulation of cells to actively grow and divide. As shown in the accompanying sequence, a single base-pair mutation results in a mutant protein that is constitutively active, leading to continual promotion of cell proliferation. Such mutations play a role in the formation of cancer. You have cloned the wild-type version of the mouse RAS gene and wish to create a mutant form to study its biological activity in vitro and in transgenic mice. Outline how you would proceed.

800
views
Textbook Question

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC

650
views
Textbook Question

You have cloned a gene for an enzyme that degrades lipids in a bacterium that normally lives in cold temperatures. You wish to transfer this gene into E. coli to produce industrial amounts of enzyme for use in laundry detergent.

You have managed to produce transgenic E. coli expressing mRNA of your gene, but only a low level of protein is produced. Why might this be so? How could you overcome this problem?

532
views