Ch. 16 - Genomics: Genetics from a Whole-Genome Perspective

Sanders - Genetic Analysis: An Integrated Approach 3rd Edition

Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook

Sanders 3rd Edition

Ch. 16 - Genomics: Genetics from a Whole-Genome Perspective

Problem 16c

Chapter 16, Problem 16c

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.
For gene Z, gene duplications have occurred in all species. Define orthology and paralogy relationships for the different Z genes.

Verified step by step guidance

Understand the concepts of orthology and paralogy: Orthologous genes are genes in different species that originated from a single gene in the last common ancestor (LCA) and retain the same function. Paralogous genes, on the other hand, are genes within the same species or different species that arose from a gene duplication event and may have diverged in function.

Examine the phylogenetic tree: Identify the point where the lineage leading to species A diverges from the lineage leading to species B and C. This divergence represents the LCA of all three species.

Trace the gene duplication events: For gene Z, determine where duplications occurred in the phylogenetic tree. Gene duplications can occur before or after the divergence of species. This will help distinguish between orthologs and paralogs.

Define orthology relationships: Identify the Z genes in species B and C that share a direct evolutionary relationship with the Z gene in species A. These genes are orthologs because they originated from the same ancestral gene in the LCA.

Define paralogy relationships: Identify the Z genes within each species (A, B, and C) that arose from gene duplication events. These genes are paralogs because they are derived from duplication within the same lineage, either before or after the divergence of species.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.

Video duration:

Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

Orthology

Orthology refers to genes in different species that evolved from a common ancestral gene through speciation. These genes typically retain similar functions across species. In the context of species A, B, and C, the Z genes that are derived from the last common ancestor and are present in all three species would be considered orthologs.

Paralogy

Paralogy describes the relationship between genes that arise from duplication events within the same genome. These genes can evolve new functions over time. In the case of gene Z, if duplications occurred in species A, B, or C, the resulting Z genes would be classified as paralogs, as they originated from a single ancestral gene but diverged after duplication.

Phylogenetic Trees

Phylogenetic trees are diagrams that represent the evolutionary relationships among various species based on their genetic information. They illustrate how species diverged from common ancestors over time. In this question, the phylogenetic tree helps visualize the divergence of species A, B, and C, providing context for understanding the orthology and paralogy of gene Z.

Recommended video:

Guided course

08:16

Phylogenetic Trees

Related Practice

Textbook Question

You have isolated a gene that is important for the production of milk and wish to study its regulation. You examine the genomes of human, mouse, dog, chicken, pufferfish, and yeast and note that all genomes except yeast have an orthologous gene.

What does the existence of orthologous genes in chicken and pufferfish tell you about the function of this gene?

439

views

Textbook Question

Consider the phylogenetic trees below pertaining to three related species (A, B, and C) that share a common ancestor (last common ancestor, or LCA). The lineage leading to species A diverges before the divergence of species B and C.

For gene X, no gene duplications have occurred in any lineage, and each gene X is derived from the ancestral gene X via speciation events. Are genes AX, BX, and CX orthologous, paralogous, or homologous?

392

views

Textbook Question

In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.

5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'

5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'

5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'

Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.

486

views

Textbook Question

For gene Y, a gene duplication occurred in the lineage leading to A after it diverged from that, leading to B and C. Are genes AY1 and AY2 orthologous or paralogous? Are genes AY1 and BY orthologous or paralogous? Are genes BY and CY orthologous or paralogous?

438

views

Textbook Question

How would you identify the regulatory elements important for the expression of your isolated gene in mammary glands?

532

views

Textbook Question

When the human genome is examined, the chromosomes appear to have undergone only minimal rearrangement in the 100 million years since the last common ancestor of eutherian mammals. However, when individual humans are examined or when the human genome is compared with that of chimpanzees, a large number of small indels and SNPs can be detected. How are these observations reconciled?

442

views