11. Translation
The Genetic Code
49PRACTICE PROBLEM
Given the following DNA template strand: 3'- TACGTACGTCGAGGCTATTCTAGG -5', what would be the amino acid sequence of the resulting polypeptide chain assuming that the reading frame begins with the first base of the sequence?
Given the following DNA template strand: 3'- TACGTACGTCGAGGCTATTCTAGG -5', what would be the amino acid sequence of the resulting polypeptide chain assuming that the reading frame begins with the first base of the sequence?