15. Gene Expression

Review of Transcription vs. Translation

From DNA to protein - 3D

Animation: Overview of Protein Synthesis in Bacteria

 No. In eukaryotic cells, the transcription of a pre-mRNA is followed by processing. The mRNA then moves to the cytoplasm, where ribosomes construct a polypeptide based on the codons in the RNA. The polypeptide is then modified, if necessary. 

Consider the molecules involved in the transfer of information from DNA to protein.

What is their proper sequence for these steps? 1. translation 2. RNA processing 3. transcription 4. modification of protein

Animation: Overview of Protein Synthesis in Eukaryotes

DNA Transcription and Translation | DNA to Protein

 No. Translation only involves RNA (rRNA, tRNA, and mRNA), and thymine is only present in DNA. 

 when an mRNA codon paired with a tRNA anticodon 

Consider the specific nucleotides that are under consideration.

At one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred __________.

 Replicated DNA leaves the nucleus, is transported to a ribosome, and catalyzes the polymerization of amino acids in a protein. 

 No. DNA does not leave the nucleus and does not participate in the translation process. 

 DNA exchanges its thymine units with uracil in polymerase. This activates polymerase, and it starts joining amino acids together. 

 Transfer RNAs line up on a ribosome, and amino acids bind to them with hydrogen bonds. 

 No. Translation does not work in this way. 

 Messenger RNA is made on a DNA template, and then amino-acid-bearing transfer RNAs bind to the mRNA through codon-anticodon pairing. 

Follow the flow of information in the cell and think about the meanings of transcription and translation.

Which summary of protein synthesis is correct?

Which of the following polypeptide chains are synthesized from the RNA sequence:5’ – AUGAUCCGAAGUGGCACAGCAUAA - 3’<img src="https://static.studychannel-prd.pearsonprd.tech/courses/biology/thumbnails/images/62caaf08" class="fr-fic fr-dii">

Transcription vs. Translation

Consider a DNA coding strand with the following sequence: &nbsp;3’-C T T C A T A G C T C G-5’.Use the genetic code to determine the corresponding amino acid sequence of the translated protein. &nbsp; &nbsp; &nbsp; DNA Coding Strand: 3’- C &nbsp;T &nbsp;T &nbsp;C &nbsp;A &nbsp;T &nbsp;A &nbsp;G &nbsp;C &nbsp;T &nbsp;C &nbsp;G -5’ &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;mRNA Strand: &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;Protein Sequence: <img src="https://lightcat-files.s3.amazonaws.com/problem_images/57207325aab6c1e1-1613589719826.jpg" class="fr-fic fr-dii">

The primary cause of death from αα-amanitin poisoning is liver failure. Suppose a physician informs you that liver cells die because their rate of protein production falls below a level needed to maintain active metabolism. Given that αα-amanitin is an inhibitor of transcription, you wonder if this information is correct. Propose an experiment to determine whether the toxin also has an effect on protein synthesis.

 No. Polysomes are involved in translation. 

 groups of lysosomes degrading the same protein 

 groups of ribosomes translating the same mRNA 

What does the prefix "poly-" stand for?

Polysomes may be defined as __________.

Consider a DNA template strand of the following sequence: 5’-A C T G C C A G G A A T-3’.A) What is the sequence of the corresponding DNA coding strand? &nbsp;Include directionality.&nbsp; &nbsp;DNA Template Strand: &nbsp;5’-A C T G C C A G G A A T-3’. &nbsp; &nbsp;DNA Coding Strand: B) What is the sequence of the corresponding mRNA strand? &nbsp;Include directionality.&nbsp; &nbsp;mRNA Strand:

Basic Steps of Translation and Transcription

BioFlix: Protein Synthesis

Multidirectional Transcription & Translation.

What is the central dogma of molecular biology directly referring to?

Learn the toughest concepts covered in Biology1&2 with step-by-step video tutorials and practice problems by world-class tutors 

Jason

General Biology

https://static.studychannel-prd.pearsonprd.tech/courses/biology/thumbnails/biology

#FFFFFF

yourgenome

MooMooMath and Science

Jason Amores Sumpter

Dr Matt & Dr Mike

Beverly Biology

1. Introduction to Biology

2. Chemistry

3. Water

4. Biomolecules

5. Cell Components

6. The Membrane

7. Energy and Metabolism

8. Respiration

9. Photosynthesis

10. Cell Signaling

11. Cell Division

12. Meiosis

13. Mendelian Genetics

14. DNA Synthesis

16. Regulation of Expression

17. Viruses

18. Biotechnology

19. Genomics

20. Development

21. Evolution by Natural Selection

22. Evolution of Populations

23. Speciation

24. History of Life on Earth

25. Phylogeny

26. Prokaryotes

27. Protists

28. Plants

29. Fungi

30. Overview of Animals

31. Invertebrates

32. Vertebrates

33. Plant Anatomy

34. Vascular Plant Transport

35. Soil

36. Plant Reproduction

37. Plant Sensation and Response

38. Animal Form and Function

39. Digestive System

40. Circulatory System

41. Immune System

42. Osmoregulation and Excretion

43. Endocrine System

44. Animal Reproduction

45. Nervous System

46. Sensory Systems

47. Muscle Systems

48. Ecology

49. Animal Behavior

50. Population Ecology

51. Community Ecology

52. Ecosystems

53. Conservation Biology

[BOOK BIO] CLUTCH

Introduction to Types of RNA

Central Dogma

Genetic Code

Steps of Translation

Introduction to Transcription

Steps of Transcription

Introduction to Translation

Mutations

Eukaryotic RNA Processing and Splicing

Post-Translational Modification

General Chemistry

Jules

Study the key concepts of Physics with descriptive videos, questions, and more

Physics

Patrick

Financial Accounting

Brian

Dive deep into Psychology with videos, practice problems, and more.

Psychology

Microeconomics

The first in a two-course sequence introduces the basic structure and functions of the human body

Anatomy & Physiology

College Algebra covers algebraic topics and skills necessary to succeed in college-level math

College Algebra

Organic Chemistry

Johnny

Genetics

Kylia

GOB Chemistry

Microbiology

Cell Biology

Analytical Chemistry

Study topics incliding trogonometric functions, identities and equations, solutions of triangles, complex numbers, and other topics as time permits

Trigonometry

Learn the toughest concepts covered in Precalculus with step-by-step video tutorials and practice problems by world-class tutors

Precalculus

Biochemistry

Macroeconomics

Chemistry

Biology

Math

Business

Social Sciences

Michelle Barry Franco

Building Great Presentations

Eric Zackrison, PhD

Critical Thinking And Problem Solving

Sam Bennett

Embracing Times Of Uncertainty

Nicole Tetreault, PhD

Emotional Intelligence Basics

Eugene Choi, PharmD

Enhancing Your Critical Thinking Skills

Jason Richardson, PsyD

Habits To Win Every Day

Alyssa Lowery, PhD

Having Powerful Advanced Conversations

Don Gilman, EdD

How To Influence & Persuade

Amy Matthews

Leadership Skills For Rising Stars

Listening To Lead

Michael Shermer, PhD

Making Decisions Under Uncertainty

Lynne Hurdle

Mistakes To Avoid When Resolving Conflict

Michael Veltri

Overcoming Decision Making Traps

Mike Vardy

Prioritizing Effectively

Secrets Of Effective Prioritization

Strategies To Build Up Your Creativity

Tools For Decision Making

Tutti Taygerly

Unleash And Advance Your Creativity

Winning Collaboration: How To Work More Effectively With Different Personalities