Multiple Choice
Which of the following polypeptide chains are synthesized from the RNA sequence:
5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'
2430
views
17
rank
15. Gene Expression
Review of Transcription vs. Translation
Struggling with General Biology?
Join thousands of students who trust us to help them ace their exams!Watch the first videoMultiple Choice
Polysomes may be defined as __________.
A
microfilaments and microtubules
B
groups of lysosomes degrading the same protein
C
groups of chromosomes
D
groups of ribosomes translating the same mRNA
Verified step by step guidance1
Understand the term 'polysomes': Polysomes, or polyribosomes, are clusters of ribosomes bound to a single mRNA molecule, simultaneously translating it into protein.
Recognize the function of ribosomes: Ribosomes are the cellular machinery responsible for protein synthesis, translating mRNA sequences into polypeptide chains.
Identify the role of mRNA: Messenger RNA (mRNA) carries the genetic information from DNA to the ribosome, where it serves as a template for protein synthesis.
Visualize the process: Imagine multiple ribosomes attached to a single mRNA strand, each at different stages of translating the mRNA into a protein. This assembly is what constitutes a polysome.
Differentiate from other options: Microfilaments and microtubules are components of the cytoskeleton, lysosomes are involved in degradation, and chromosomes carry genetic information. None of these are related to the definition of polysomes.
4:07mWatch next
Master Review of Transcription vs. Translation with a bite sized video explanation from Jason
Start learningRelated Videos
Related Practice
Review of Transcription vs. Translation practice set
Problem sets built by lead tutorsExpert video explanations