Central Dogma

According to the central dogma, what is the intermediate molecule involved in the flow of information in a cell that should go in the blank? DNA → ________ → Proteins

The full process by which genotype becomes expressed as phenotype is called:

Which of the following is the best definition of a gene?

Which of the following statements is false?

The strand of DNA that has the same sequence as the RNA molecule being created during transcription is the:

Transcription is sometimes described as a process in which RNA is "copied" from the template strand of DNA. This statement is potentially misleading since _____.

Transcription in eukaryotes requires which of the following molecules in addition to RNA polymerase?

During transcription of DNA to RNA:

What happens during the initiation step of DNA transcription?

Which of the following properties is NOT shared by RNA polymerase and DNA polymerase?

Which of the following processes occurs in eukaryotic gene expression?

A mRNA poly-A tail:

The regions in DNA & RNA that encode actual gene products are known as:

Which type of RNA contains groups of 3 nucleotides that code of a specific amino acid?

Which type of RNA carries amino acids to the ribosome used in polypeptide creation?

A particular triplet of bases in the template strand of DNA is 5′-AGT-3′. What would be the corresponding codon for the mRNA that is transcribed?

A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that binds the mRNA codon is ________.

Which of the following sequences of nucleotides are possible in the template strand of DNA that would code for the polypeptide sequence Phe–Leu–Ile–Val?

What amino acid sequence will be generated, based on the following mRNA codon sequence? 5′–AUG–UCU–UCG–UUA–UCC–UUG–3′

What type of bonding is responsible for maintaining the shape of the tRNA molecule shown in the figure?

The tRNA shown in the figure has its 3′ end projecting beyond its 5′ end. Which of the following processes will occur at this 3′ end?

A ribosome has three tRNA binding sites. Which answer matches the tRNA binding site with the correct function:

Which of the following statements concerning ribosomes are true?

The direction of ribosome movement during translation is in the ______________.

Many antibiotics work by blocking the function of ribosomes. Therefore, these antibiotics will:

Which of the following processes is the first event to take place in translation?

Which of the following does not occur during translation's termination step?

What is the function of the release factor during translation?

Glycosylation is the post-translational addition of ________ to the protein.

Which of the following is a reversible form of post-translational modification which can activate or deactivate a protein depending on the protein which is being modified?

What is the central dogma of molecular biology directly referring to?

Consider a DNA template strand of the following sequence: 5’-A C T G C C A G G A A T-3’.

A) What is the sequence of the corresponding DNA coding strand?  Include directionality.

   DNA Template Strand:  5’-A C T G C C A G G A A T-3’.

   DNA Coding Strand:

B) What is the sequence of the corresponding mRNA strand?  Include directionality.

   mRNA Strand:

Consider a DNA coding strand with the following sequence:  3’-C T T C A T A G C T C G-5’.

Use the genetic code to determine the corresponding amino acid sequence of the translated protein.

      DNA Coding Strand: 3’- C  T  T  C  A  T  A  G  C  T  C  G -5’

               mRNA Strand:

         Protein Sequence:

Which of the following polypeptide chains are synthesized from the RNA sequence:

5’ – AUGAUCCGAAGUGGCACAGCAUAA - 3’

Which of the following mutations, occurring just after the start codon in the mRNA is likely to have the most serious effects on the polypeptide product?

A nonsense mutation: