Multiple Choice
Which of the following polypeptide chains are synthesized from the RNA sequence:
5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'
2518
views
21
rank
Table of contents
- 1. Introduction to Biology
- 2. Chemistry
- 3. Water
- 4. Biomolecules
- 5. Cell Components
- 6. The Membrane
- 7. Energy and Metabolism
- 8. Respiration
- 9. Photosynthesis
- 10. Cell Signaling
- 11. Cell Division
- 12. Meiosis
- 13. Mendelian Genetics
- Introduction to Mendel's Experiments
- Genotype vs. Phenotype
- Punnett Squares
- Mendel's Experiments
- Mendel's Laws
- Monohybrid Crosses
- Test Crosses
- Dihybrid Crosses
- Punnett Square Probability
- Incomplete Dominance vs. Codominance
- Epistasis
- Non-Mendelian Genetics
- Pedigrees
- Autosomal Inheritance
- Sex-Linked Inheritance
- X-Inactivation
- 14. DNA Synthesis
- 15. Gene Expression
- 16. Regulation of Expression
- Introduction to Regulation of Gene Expression
- Prokaryotic Gene Regulation via Operons
- The Lac Operon
- Glucose's Impact on Lac Operon
- The Trp Operon
- Review of the Lac Operon & Trp Operon
- Introduction to Eukaryotic Gene Regulation
- Eukaryotic Chromatin Modifications
- Eukaryotic Transcriptional Control
- Eukaryotic Post-Transcriptional Regulation
- Eukaryotic Post-Translational Regulation
- 17. Viruses
- 18. Biotechnology
- 19. Genomics
- 20. Development
- 21. Evolution
- 22. Evolution of Populations
- 23. Speciation
- 24. History of Life on Earth
- 25. Phylogeny
- 26. Prokaryotes
- 27. Protists
- 28. Plants
- 29. Fungi
- 30. Overview of Animals
- 31. Invertebrates
- 32. Vertebrates
- 33. Plant Anatomy
- 34. Vascular Plant Transport
- 35. Soil
- 36. Plant Reproduction
- 37. Plant Sensation and Response
- 38. Animal Form and Function
- 39. Digestive System
- 40. Circulatory System
- 41. Immune System
- 42. Osmoregulation and Excretion
- 43. Endocrine System
- 44. Animal Reproduction
- 45. Nervous System
- 46. Sensory Systems
- 47. Muscle Systems
- 48. Ecology
- 49. Animal Behavior
- 50. Population Ecology
- 51. Community Ecology
- 52. Ecosystems
- 53. Conservation Biology
15. Gene Expression
Review of Transcription vs. Translation
Back15. Gene Expression
Review of Transcription vs. Translation
- Multiple ChoiceAt one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred __________.1423views
- Multiple ChoiceWhich summary of protein synthesis is correct?1862views
- Multiple ChoiceWhat is their proper sequence for these steps?
1. translation
2. RNA processing
3. transcription
4. modification of protein1637views - Multiple ChoicePolysomes may be defined as __________.1224views